gistfile1.PL

# this is mainly GFF3-specific, GFF2/GTF to be added

my ($io, $f, $s, $fcount, $scount);

################################################################################
#
# use FeatureIO::gff to read a FASTA file.
#
$fcount = 0;
$scount = 0;

ok( $io = Bio::FeatureIO->new( -file => test_input_file('dna1.fa') ) );

#read features
while($f = $io->next_feature()){
    warn $f;
    $fcount++;
}
is($fcount, 0);

#then try to read sequences again.  should get seqs now
while($s = $io->next_seq()){
    $scount++;
    TODO: {
	local $TODO = 'How did this ever work?!?';
	if ($scount == 1) {
	    is($s->seq, 'Test1');
	}
    }
}
is($scount,  1);

__END__

Result:

not ok 4 # TODO How did this ever work?!?

#   Failed (TODO) test at t/SeqFeature/FeatureIO.t line 43.
#          got: 'TTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACC'
#     expected: 'Test1'