Last active
February 10, 2021 15:57
-
-
Save AntonPetrov/177cef0a3b4799f01536 to your computer and use it in GitHub Desktop.
An example script for retrieving RNAcentral ids for a given sequence.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
""" | |
Copyright [2009-present] EMBL-European Bioinformatics Institute | |
Licensed under the Apache License, Version 2.0 (the "License"); | |
you may not use this file except in compliance with the License. | |
You may obtain a copy of the License at | |
http://www.apache.org/licenses/LICENSE-2.0 | |
Unless required by applicable law or agreed to in writing, software | |
distributed under the License is distributed on an "AS IS" BASIS, | |
WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. | |
See the License for the specific language governing permissions and | |
limitations under the License. | |
An example Python script showing how to retrieve the RNAcentral id for an RNA sequence. | |
Usage: | |
python retrieve_rnacentral_id.py | |
""" | |
import hashlib | |
import requests # pip install requests | |
def get_md5(sequence): | |
""" | |
Calculate md5 for an RNA sequence | |
""" | |
# RNAcentral stores DNA md5 hashes | |
sequence = sequence.replace('U','T') | |
# get the md5 digest | |
m = hashlib.md5() | |
m.update(sequence) | |
return m.hexdigest() | |
# get the RNAcentral id | |
def get_rnacentral_id(md5): | |
""" | |
Parse json output and return the RNAcentral id. | |
""" | |
url = 'https://rnacentral.org/api/v1/rna' | |
r = requests.get(url, params = {'md5': md5}) | |
data = r.json() | |
if data['count'] > 0: | |
return data['results'][0]['rnacentral_id'] | |
else: | |
return 'RNAcentral id not found' | |
# This sequence has an RNAcentral id | |
sequence = 'CUGAAUAAAUAAGGUAUCUUAUAUCUUUUAAUUAACAGUUAAACGCUUCCAUAAAGCUUUUAUCCA' | |
md5 = get_md5(sequence) | |
print get_rnacentral_id(md5) # URS00002C9E9D | |
# This sequence doesn't have an RNAcentral id | |
sequence = 'Not an RNA sequence' | |
md5 = get_md5(sequence) | |
print get_rnacentral_id(md5) # RNAcentral id not found |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment
Hi Anton,
A minor comment: the years in the copyright notice need updating
Matthieu