Last active
August 29, 2015 14:02
-
-
Save robsyme/8d6e20966db2d967bb51 to your computer and use it in GitHub Desktop.
NCBI Blast+ error: ncbiobj.cpp", line 925: Critical: ncbi::CObject::ThrowNullPointerException()
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
FROM ubuntu:14.04 | |
MAINTAINER Robert Syme <robsyme@gmail.com> | |
RUN sed 's/main$/main universe/' -i /etc/apt/sources.list | |
ENV DEBIAN_FRONTEND noninteractive | |
RUN apt-get update -qq | |
RUN apt-get upgrade -qqy | |
# Get wget | |
RUN apt-get install -qqy wget | |
# Install ncbi-blast+ | |
RUN wget ftp://ftp.ncbi.nih.gov/blast/executables/blast+/2.2.29/ncbi-blast-2.2.29+-x64-linux.tar.gz && \ | |
tar -xzvf *.tar.gz && \ | |
mv ncbi-blast-2.2.29+ /blast | |
# LINECOUNT of 82 works fine, but 83 throws a critical ncbi::CObject::ThrowNullPointerException() | |
ENV LINECOUNT 83 | |
ADD https://raw.githubusercontent.com/KorfLab/CEGMA_v2/master/sample/sample.dna / | |
RUN head -n $LINECOUNT sample.dna > subject.fasta && \ | |
/blast/bin/makeblastdb -in subject.fasta -dbtype nucl -out subject && \ | |
echo ">foo" > query.fasta && \ | |
echo "gtatatttttacgtaatagcttctttgacatcaataagtatttgcctata" >> query.fasta | |
ENTRYPOINT /blast/bin/blastn -db subject -query query.fasta |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment