Created
April 3, 2012 02:22
-
-
Save dcjones/2288846 to your computer and use it in GitHub Desktop.
The fasta benchmark in Julia
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
const line_width = 60 | |
const alu = strcat( | |
"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG", | |
"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA", | |
"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT", | |
"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA", | |
"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG", | |
"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC", | |
"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA") | |
const iub = | |
(b"acgtBDHKMNRSVWY", | |
[0.27, 0.12, 0.12, 0.27, 0.02, | |
0.02, 0.02, 0.02, 0.02, 0.02, | |
0.02, 0.02, 0.02, 0.02, 0.02]) | |
const homosapiens = | |
(b"acgt", | |
[0.3029549426680, 0.1979883004921, | |
0.1975473066391, 0.3015094502008]) | |
const IM = 139968 | |
const IA = 3877 | |
const IC = 29573 | |
const IMf = float64(IM) | |
rng_state = 42 | |
function gen_random(max::Float64) | |
global rng_state = (rng_state * IA + IC) % IM | |
max * float(rng_state) / IMf | |
end | |
function repeat_fasta(src, n) | |
k = length(src) | |
s = strcat(src, src, src[1:n % k]) | |
for j = 0:div(n, line_width) - 1 | |
i = j * line_width % k | |
println(s[i + 1:i + line_width]) | |
end | |
if n % line_width > 0 | |
println(s[end - (n % line_width) + 1:]) | |
end | |
end | |
function choose_char(cs) | |
k = length(cs) | |
r = gen_random(1.0) | |
if r < cs[1]; return 1; end | |
a::Uint = 1 | |
b::Uint = k | |
while b > a + 1 | |
c = div(a + b, 2) | |
if r < cs[c]; b = c; else a = c; end | |
end | |
b | |
end | |
function random_fasta(symb, pr, n) | |
cs = cumsum(pr) | |
line = Array(Uint8, line_width) | |
k = n | |
while k > 0 | |
m = min(k, line_width) | |
for i = 1:m | |
line[i] = symb[choose_char(cs)] | |
end | |
println(line[1:m]) | |
k -= line_width | |
end | |
end | |
const n = int(ARGS[1]) | |
println(">ONE Homo sapiens alu") | |
repeat_fasta(alu, 2n) | |
println(">TWO IUB ambiguity codes") | |
random_fasta(iub[1], iub[2], 3n) | |
println(">THREE Homo sapiens frequency") | |
random_fasta(homosapiens[1], homosapiens[2], 5n) | |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment