Skip to content

Instantly share code, notes, and snippets.

Embed
What would you like to do?
Add linker sequence to ERCC (NIST SRM2374) spikes
NOTE: this patch is not needed anymore, since NIST started to distribute
the spike sequences at the following URL.
https://www-s.nist.gov/srmors/certificates/documents/SRM2374_putative_T7_products_NoPolyA_v1.fasta
Description: Adds linker sequences to ERCC (NIST SRM2374) spikes
The U.S. National Institute of Standards and Technology (NIST)
provides the sequence of the inserts that have been cloned
into plasmids to create the External RNA Controls Consortium
(ERCC) spikes. These spikes are commercially available as
in-vitro transcribed RNAs. In that case, the RNA sequence starts
with linker sequences in addition to the insert sequence. Two Gs
from the T7 RNA polymerase promoter, one EcoRI site (GAATTC) followed
in some cases by a SacI (GAGCTC) and a KpnI site (GGTACC). Details
can be found on the NIST's website (https://www-s.nist.gov/srmors/view_detail.cfm?srm=2374).
.
See also the discussion on Biostars: https://www.biostars.org/p/170234/
.
This patch adds the linker sequences to the insert sequence files
provided by NIST. The spike sequences are in the public domain,
and so is this patch. Charles Plessy <plessy@riken.jp>
--- a/SRM2374_ambiguities_resolved_NoPolyA_v1.FASTA
+++ b/SRM2374_ambiguities_resolved_NoPolyA_v1.FASTA
@@ -1,4 +1,5 @@
>ERCC-00002
+GGGAATTC
TCCAGATTACTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGAC
CGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATT
CCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGC
@@ -18,6 +19,7 @@
ACTGGTAGGCGTTAGACCCCGTGACTCGTGGCTGAACGGCCGTACAACTCGACAGCCGGT
GCTTGCGTTTTACCCTT
>ERCC-00003
+GGGAATTC
CAGCAGCGATTAAGGCAGAGGCGTTTGTATCTGCCATTATAAAGAAGTTTCCTCCAGCAA
CTCCTTTCTTAATTCCAAACTTAGCTTCAGTTATAAATTCCCCTCCCATGATTGGGATTT
TATAAACTTTTCTTCCATATAATTCATCTTTCTTCTCATAACCGTCTCCGAAAAACTTCA
@@ -36,6 +38,7 @@
GATTCAGGAAATTATTGAAAGTTTGGGAGGGACTATTCACAGTATAGATGAGGTTGTTGC
AGGTAAAAAGATTATTGAAGAGTTAGAACACCACAAGAT
>ERCC-00004
+GGGAATTC
TCTTGCTTCAACAATAACGTCTCTTTCAGAAGGCATTGGTATCTTTTCCCCACTTCCAAG
CATTTTTTCAACTAATCTTATGTTATTAACCATTTCCTTAAATTCTTCTGGGTCTGCTGA
CAAAGCATGATCAGGACCTTCCATATTTTTATCTAAGGTAAAGTGCTTCTCAATAACATC
@@ -46,6 +49,7 @@
CGGCTTGCCTGTTTTTGCCACTTTTTCTAATAAGGGATAAAAGGTTAAATCACCAGAGGC
AATTTTAAATCAGGCACAT
>ERCC-00009
+GGGAATTC
CAATGATAGGCTAGTCTCGCGCAGTACATGGTAGTTCAGCCAATAGATGCCTAGTACGCT
GACGGCATTCAGAGTACGCTGATCGGCTTATGACGTATGTGACGCAGCTCTTAGCGCAAT
GTATGTGCTGTTATCGAAGCCTATGGCTGAGTATGTAACGCTATGGCGTGCTAGTCGTCT
@@ -63,6 +67,7 @@
CAATGATCGACCTGGAGTCTAATATCTGACCACGCCTTGTAATCGTATGACACGCGCTTG
ACACGACTGAATCCAGCTTAAGAGCCCTGCAACGCGATATACAGGCGCTGCTACCGATAT
>ERCC-00012
+GGGAATTC
CGAGAGATGTTTGTAGGTGCGGAATGTGTGCGGTCTACCTTAGCTGTAGTGTGCGATGAA
CCTACACACAACGTGGTATAGTGGCCGATCTTAGAGTGATCCTATCACTCCTTACGCACC
AGAAGGGATCTGCATACCAGGCGGAGAACTTGGAAGGCGGCTAGATCACTGAATTGCGGG
@@ -81,6 +86,7 @@
CGGTGCGCTCGGCCTAGGCGCTTACTGCATGGGGGCTGTGGGCAATTTGGTATTTCTCAG
GACTATGGAC
>ERCC-00013
+GGGAATTC
ACCGAGCTCAGATGTGAAGGATCTTCTTGGAGGATTAAAAAAATGATTATCTGTAAAACC
CCACGTGAACTTGGTATCATGCGGGAAGCAGGGCGAATCGTGGCTTTAACTCATGAAGAG
TTAAAAAAGCACATTAAACCAGGAATCTCGACAAAAGAATTGGATCAAATTGCCGAACGT
@@ -96,6 +102,9 @@
AAGTGTGCTCATTTTGAACATACGATTGCGATTACGGAAACGGTTTTTGAATACTGACGA
GAGT
>ERCC-00014
+GGGAATTC
+GAGCTC
+GGTACC
AAAAGAAGAAGGAAAGTAGAGGAGATCAAGATGTCAAACGAAACAATTAAATTAGTCATT
GCGGGACCGCGTGGAAGAATGGGGCAGGAAGCTGTTAAATTGGCAGAACGAACACCACAT
TTTGACCTTGTAGGGGCCATAGACCATACATACGATCAGCAAAAATTATCTGATGTGATG
@@ -130,6 +139,8 @@
GAGAGAAAAGCTTTACGGTAAAGAAGCGGGCGTGGAGTATGCCGAAGGTTTCTTTTCCAA
ACGGATGCTGAAGCTTG
>ERCC-00016
+GGGAATTC
+GAGCTC
GTTGTAACGAATGTTAATTTAGGAGGCAAGAGTTTGTGGGCGCGGACTTGCAGCTCGTAA
CGCTCTAAAAGGGTTATGCCGCTGAGGCGGGACCATAGTCAGGAAGTTTGTCCGATCCGC
TCCAGTTGTCAAGAGTAGAGGATTTCGTGTTCGCCGATACTGCCGAAAACGTCATACCGA
@@ -145,6 +156,7 @@
GGTTACGACCCTCCAGAGTGATCCGACGGCGATGTGTCTTTGACCCCCGTGTGACTGGTG
TTCCTGTCGTATCCGCAACATGTTTACTCATCACTACGTT
>ERCC-00017
+GGGAATTC
GAGAACTGAAAGTGAGTCCCAACGAGAGAGGTGCATCTGTCCAGTGAGAGCTGACTGTCT
GCGACAACACTAGTCGGTCCAGGCATGGATTTCGCGACCTCACAACTTAAGGAGGCGGTA
AATCAGATGACAGCGCGACCCTGTAATGGGTGACCTGCTAGTGGAGGTGGCGCGGTGTCC
@@ -165,6 +177,7 @@
AGTAAGTCTTACGAGATGATCCCGACCCAGGACTGGAGCTAGGCGGTTGCGCAAGTAACT
TCATCATGTATCGCTGGGGAATAATGTTCCTGG
>ERCC-00019
+GGGAATTC
CTTTAATGGTTGTACATACTTGACGGATTGCAGTGAGTGTATTCCCGTCCCATCGTATGG
GTAACCCATAGGGGCGTGTCATTCAGCACTTCGGATAGTGTTTGACCGCGTCGCTCCCAT
GTCGCCTTTCAGGAGAAATAGTACAGGCTGCTGGCTCATGTTTCCTTCTACGCTGCACTT
@@ -177,6 +190,7 @@
CCCGGTAATCTTGCCGCCGTAGGGAGTACGAGCAGTGCACCGTTGAAACAAGCACAGGAG
GTATGAAGCATCAGACCTG
>ERCC-00022
+GGGAATTC
CCCGGGCCAATTGCCTCTATAACTAGAGCTGAGCCCACCATTAAAGCGATTTTTTCGCAC
TTAGCCGTAATAAATATAATGATCCCGCGGTGTAGTAATTCTACGGAATGCACGGAATGT
CATAAGCAGAAGGACGTGATGTGCAACCTACTCCCCTTTCCCAAGTAAATGTACGGGAAT
@@ -191,6 +205,7 @@
AGAACCATAGCGCTTGGGTTTGTGACTTTCTCCCTAGATACGCGTTTGCTGACTGCGCTA
CATGGAT
>ERCC-00024
+GGGAATTC
ACGGAGGAGCTTTGGCATACTAGGCTAGCGAATCTGCAACTAACGCAAGTTACATCCTAG
CTAGCGAAGGGCGTCCCAATTTTCGCTAACCCGACGCGACGCATAAAAAGCGAGAATAAC
GCCTAAGGGATGTACAATGGATGTTGATTATGCCTTCGGGAATGAGGGATGATTTGCGAA
@@ -201,6 +216,7 @@
GCATACGGCTTCCACCAACCCATAGTACTTGGTAACTATAGCAATCAAGCACGCGTGAGC
ACAACGCTATCCAAATTACTACATTAACTGG
>ERCC-00025
+GGGAATTC
GGGGTCCATTATAGTGCAGGCGTGGTAAAGTAGCATTAGAACCCTACTACTTAGCCCGCG
CAACTCGTCCTATTAAAAGTCGGAAGGATTAGGGAAGTTAACCTCCGTTAGGGCCTCATT
GGCGCGCCTCCACGTATCTGTATTCCCGTGTCCCGACTGGCTAATAAGAGATATGGTGCA
@@ -235,6 +251,8 @@
TTACTCTGACGGGGGTTGTCACTAGGCTGGTGGGTCCTTTCGCCTCTCATGTCAATTCCC
TTTGTTGGGCTGCTTGGAAGTACTGATACTAGAGTAGCCTAGTAATACCT
>ERCC-00028
+GGGAATTC
+GAGCTC
AAGAAAGTATTCCATTCCGGCTCATGGTCCCGGCTAGACCTGCAAGATCGAAGGTACTCA
ATGACACCAGTGACTGAGCGGTCAGCCCGGAAATAGCCAGAAATGTTACCATCCCCGCAT
GTTACACAAACGTCGGGCTGACGGAACCCATGAGAACCTATGGTGAATAGACAGTAAACG
@@ -255,6 +273,7 @@
TACAAGGTAAACAACGGGGAATATAATTCAGTTGAACCGGTGTGGAGCCTGCACTTGGAA
CGCTGCATAAGGGACCCAACAGCCCC
>ERCC-00031
+GGGAATTC
GGGAGAAAAGCTTCTTGCCTAGTTACAGCACGAAGATTGGGACCCATCGATCAGCGCCTC
CGTGCAATGGCGCCTTGGTACACTCTCTAAAATGCAGTCGGTAGCGGGGCATGTAGTTAC
TGCGGTGATATTAAGCTAGTGAGTAACCTTATATCGAACTGTCTACCAAATTGATGTATC
@@ -275,6 +294,8 @@
GTGATAGAGTCTTCGCATCAGGTTACACCATGTCGACTGATAGTAACTGTGGTTCGAGTT
ATGCGTGTTGACACACCGTTGAGGCGCCCTATTT
>ERCC-00033
+GGGAATTC
+GAGCTC
GCACGCCCTATTTAACTGGAAACCTTCCAAGATTCGGAGAGCATATAAGTTGGGCCGAAA
GCTCAGCTGTGAGCTTTGCAAACTCTGTCTTAGGAGCTAAGACAAATAGAGAAGGTGGGC
CATCAGCATTAGCAGCTGCAATTATTGGAAAAACACCATATTATGGATATCACTTAGATG
@@ -310,6 +331,7 @@
GCAAATGAGCTTTTAAACTTAGGATTTAAAGTTGCTATAGTCGATAGTGATGTAGGGCAG
AAGAGCATTTTACCTCCAGC
>ERCC-00034
+GGGAATTC
GGTATTACCCAGCACTCGTATGGCGCCCCATCGTTGTATCAGCAGGAGCATATGTTGCTC
TTGATTGTATCACTTCGCGAGAAAGACCCCTTGAATACACGAGCTGCCGTCCGGATAACG
ATGTAATAGCCTATGGAGGGGAAGTAGTCATGTCTGCGGACTATTGGTAAGAGCACCGCC
@@ -328,6 +350,7 @@
CCTCCCGGTCGCCGAACTGATATCATAGCTAAGTATGCTGGCCTCGGTTAACCGCGAAGG
CATATACAATGGATTCGCTGTCCGCGTAGCAATAT
>ERCC-00035
+GGGAATTC
GGGAGAGGTATCGTAAAGGTGAATCCTGTGGCTGTAGGAAGCAGTTCATATGACCAACGG
GCGCCCTAGGGTATACTCCAGAATCGAATGTTACCAGAAAATAGGGGAACTGGTCGCTCC
TAGGTAAGGTTGCCTGTCCCCGCACTGTACGAAGGTCCGGTCAACGGAAGCAGGCACACG
@@ -348,6 +371,7 @@
CACTCACAGCCATAAGTCCTACCTTGCTAACATCGCCCCGAATGCAGAGCCACCTACTGG
GGTTGTCTGAGAACACTCCATGGGTC
>ERCC-00039
+GGGAATTC
GAGCATGGCCTAACTGAATGCGCCTGCAGTATCTTTCTTAGTATATCAAGATCCGTAATA
TAACGGTTTGCGCGACTACGGTTACCGTCTTTATAAGTGAACAAAACCGGCTACCAGCAT
GTCGTATTTCGCCACCCATATAAACCCCACTTCGTCCTCAAGGAATCCAAAAGTCGGACG
@@ -361,6 +385,7 @@
GTGCGACGCACCTATTGGTAGGCCAATCTTATGGTTTGCCTCTTGTACTGAGGGTACCGC
AGAGGTCCACTGGTTAGCTCACACTATGATCTAGGAGCAGTTGGGCGGTAAACGGC
>ERCC-00040
+GGGAATTC
AACTACGATCCCATGAGAACACCTGTAGATACTCAGGTCTCCGCGGACCTACGCCGCGGA
CGATGATAAAGTCCGAGAAACCACCGGATTGCCCCAACAGACGGCCTAGCCCATCGAACT
AGGGAAATGAACTATATCGTAACCAAGCCGGGTAGCTGCGGTGGTGCTAGACTAGATGTT
@@ -374,6 +399,9 @@
GTGGTATCGGGTGGTTGTGAAGGATACAGATATTCTATGGGCAGCGATGGGGCTTCCTCA
GTCCGTCTACGGCCCACCAGACAAACAACTCGGGATACAAATTGAGCACCCGCGGACCGG
>ERCC-00041
+GGGAATTC
+GAGCTC
+GGTACC
ACCGAGCTCAAGATGCGTTAATTATGTGGGTGACGATAAATGAGTGAGCAAAAAGACATG
TACGTATTAGGAATTGAAACAAGCTGTGATGAGACTGCTGCAGCTATTGTGAAAAGCGGG
AAAGAGATCATTTCAAACGTAGTAGCCTCTCAAATTGAAAGCCATAAGCGCTTCGGAGGC
@@ -394,6 +422,7 @@
TATGATATGAATGGCCAGCCCGGCCTTGAATTGACTTCTTATCAAAGTCTCACGAGATAA
TAGCGTGAGACTCCCGGGTAC
>ERCC-00042
+GGGAATTC
ACCAACTCTGGCCTTTGTGTTGCTATTCCCCAAGCACACAATCCAGTATAACATCTTCCA
CAAACTCTACAGCCAAGAGCAACCATTGCAGCAGTTCCAATATAGACAGCATCTGCTCCT
AAAGCTATAGCCTTAAATACATCTGCTGAACATCTGATTCCTCCACTTGCTATGATGCTA
@@ -412,6 +441,7 @@
AACTGCTTTGGTTTTTTACCAATGTAAGTTCTTAATTCCATTGGCTCTCTCAATGGGTCG
ATGGATGGGTTTGTAACTTGCATGCATCTAAAACAATCT
>ERCC-00043
+GGGAATTC
AATACCTTTACAAATGCTTTAACAAGAGGAAATTGTGTTTTTGCCAATTTAAGACCTAAT
TTAATAGTTAAACCATTAACCTTAGTTGTTCCAAGGCATAATATAGAGAGTGAGATACAG
GATGAGCTATTTCAGGGAGTTATTCAGTATGCAGTTGCCAAGGCAGTTGCTGATTTAGAT
@@ -430,6 +460,8 @@
GAGCTTTTAAAAGAATATCAAATATTAATCGTTGGTAGAGCAATTACAAAATCAAAAGAC
CCAGGAAGAGTAATTAGGATTTTATAAACAAGATGGGTT
>ERCC-00044
+GGGAATTC
+GAGCTC
AGATAGTGACTAGGGTAAATGCCAAGCCGTCTTATAAAAGCGGTAGCGAGAGATCTTAGA
ACTCCCGGCGAACGCCCCAACTTATGCGATGTCCAGCCCCAAACGGTTGATTAGATCGGT
AGCTCCCGAACTAAGAGACCCTAAACGCTATCCGTGGACTGTGTAGGTAGGCCGTCGTCC
@@ -450,6 +482,7 @@
TGACCCCTGCGGTAAGATTATTCACTCGTCATGGATAACCGGATAATCCCGTATAACCTG
TGGGTATTATAGGCGACAATTCGAAAAAGGGCGAATTCAGGCCTGAATTCTGCAG
>ERCC-00046
+GGGAATTC
ATCTCCTCTAACTTTGGAGAGGTAGGAATGGGAGTATTTGCACTTGTGGTAACGGTATTT
GCATTATTGATGGTTTTTACTATGTTGGGTATGCTGTTCGATTTCTTAAAGGACTGAATA
TTCGGTGGCAGTATGGGATTTCTAAAAATAATGTTAAGAATTTTTGCTGGTTTTTTGCGA
@@ -460,6 +493,7 @@
AATTTGTGGAGTGAGAGGATTAAAGATAGGGAAGTTGTTGAAGTTATTGGCTGTGAGAGA
GTGCCATTGATGAAACGT
>ERCC-00048
+GGGAATTC
TCTGTAAATCCCGTAAACGAGTAGTACGAATCCGGACTTGAATACACGCGTCAATCCCTT
TTATATCCTAGAATGGACCGTGTGGACGGCAACTCAGAGATAACGCATATCTATGTGCTC
GCTTGCCCATCAAAGAAGAGACGGCGACCAAACGGACGACATATAGTGACATGGTCAACC
@@ -478,12 +512,14 @@
CTTCGACGTTATAGATATTGGCATCCCTAAACAACGAGTACCTTGTGCTACGACAGAAAA
GTGACCTG
>ERCC-00051
+GGGAATTC
TTACAATAGATGCGTTTAGAGTAGCTGGGGGAATTTTGCTCTTTAAAATAGCTTGGGACA
TGCTTCACGCAGAAATTCCAAAAACAAAGCACAAACCAGATGAAAGATTAGACCTTGAAG
ATATTGATAGTATAGTTTATGTCCCATTGGCTATTCCTTTAATCTCTGGCCCTGGAGCTA
TAACAACAACCATGATTTTGATTAGCAAAACCCAGAGTATCTTAGAGAAAGGGGTTGTTG
TTCTCTCTAT
>ERCC-00053
+GGGAATTC
ACATCTGTATAAAAAACACTACAGGGTGGTAACATGGTTCTATATAAAATTAGAAGATCA
AAAAACGATCCCTGTCCATCAATACCTTCAGCGGTAATTATAGGATATTCTGTTGGATTA
AAATTAATTACTGGACATGGAGCTCAGAGCTTAAGCAATATGGCTGGTTCTTATGCTGGA
@@ -502,12 +538,15 @@
AACCTTAGCAACGGTATTTCCAGTAGCTGGTGAGCAAATTAAATAATCATACTTTCCTAA
GCTCAATCTTCCAGTGATTGTGATGAGTAAGGATGTTCT
>ERCC-00054
+GGGAATTC
GATAAAATTGGTTTTGCCTTTCAGCAATTCAACTTAATTCCTTTATTAACTGCCTTAGAA
AATGTTGAACTTCCACTGATTTTTAAATATAGGGGAGCAATGAGCGGAGAAGAGAGGAGG
AAGAGAGCTTTAGAATGCTTAAAGATGGCAGAGTTGGAGGAGAGATTTGCCAATCACAAA
CCAAATCAGTTGAGTGGAGGGCAACAACAGAGAGTTGCTATAGCGAGGGCTTTGGCAAAC
AACCCACC
>ERCC-00057
+GGGAATTC
+GAGCTC
CTAGTGCATCCTCGTGGCATCATGCGTCTCCTCAGTAGGTCTGCGACTGATCCTAGTGCA
ATGCGTCTGAGCCTGAGCTACAGCGATATAGCCTGGATTGTGAGCGTATTTGCTGTCAGA
ACCTCAGCTCATCATGTATGATGCTGTACCATCCTGCGATACTGAAGATGCACCGCTATA
@@ -526,6 +565,7 @@
CGGTATCCTCGTCGTTAAATGGCGAACGTCGTCTGCTATAGGCAAACGTCTGTCGGTCAT
GGCAAATGTTACTCGTGTGTGCAAGAAATTACTCGCTGTC
>ERCC-00058
+GGGAATTC
GGGAGAGTAGGGCCCACTTGTCGATTCGTTTGACTAAACATGGAGAAAGCATCCGAGGGT
GGGCAGATCCGCCTAAGCAAGGTACCATTTAATCCCGGTCCCACGAAAGAGTTAACCTAT
ACGCTCAGATGGCGCCATGGTGCGTTCGGAGCCACTTTCTGCGAATTGTCCACCACTGCC
@@ -546,6 +586,7 @@
GGCACCATGGTATAGATGTAATAGGAACCATGAAACTCCCATGTCGCAAGCACTAACAGA
GCTGTAACCTCCCTCCATTAGCGGTAATCGGG
>ERCC-00059
+GGGAATTC
ATTTGATCGTAACTCGGGTGACCAATGACCATATACGGCGTATTAAGGTCGTACCCTCGG
TCTCAACTTGTCGTATGGGACTTTCAAGTACCTTAGCTCGTCGGACGCTTTAGATGACTT
ATCCATAGTCCTAAGTCCGGCGCCGGTTAAGCCGCTATTAGCGTGTGTGGACTCTCTCTA
@@ -556,6 +597,7 @@
AAAACAGCGTCATCAGCGTAGGGTATCGCTTCGCGTGTCATGACTTGGGCCACGTCTCTT
TCTCGCACATTAGGCTAGATT
>ERCC-00060
+GGGAATTC
ATCGACAATAAACAAAGAAATAGAACTTTTAACACCAGAAGGAAAAATATTTTTGAAGAA
AATTGGTTATGTTGATTACTATGAGGCAGGTAGTTTAAAATTAGCTGAAGAAACAGCAAA
AAGAGATGAGGACGTTATTATATTAAAAAATCATGGAGTAGTTTGTTTAGGTAAAGATTT
@@ -566,6 +608,7 @@
CTTCTTTAGCCTTTTCAGCAGCAGCTCTAATGTTTCTTGGAACGGTTGTATCGTTAATTA
TCTCATCCAAATCAAAGC
>ERCC-00061
+GGGAATTC
GGAGAAGCTTGGCAAACACTACCGGGCATAGATAAAGACGCGGGGCCAAGCATGCCGACA
TTGGGATACTTCCATGTTACGGGGCATGGAGGCGCAGCTATCCCACCCTCGTGCGCAAGA
TGGACAACCGAGCGCGGTAGTAATCGCGAACTGCCAGGCACTTATTGTAGAGGTGAATCG
@@ -586,6 +629,7 @@
GTGAGACGCACTAGAGGCTTAACCTGGCAGATTGTGATCTCCGATGGTAATGAAGTCGCC
GTACTATCTCTTACTTGCATGACGCGACTACC
>ERCC-00062
+GGGAATTC
ACTATTGGAGAGAAAGATATCAGCCAGACCTATTTAGTAGCTCCACAGGCGCTAATAAAA
GAGGCAGTATCATTAATTGGAAAGAGTGCTGTTGAGGGGATGATTAGAAGAAGTTCAAAT
AAATTATTCAAATAATCATAATAAAGTAATACTTATACTGAATATTCGAAATTATTATTT
@@ -604,6 +648,7 @@
ACTCCCTAACAAATCCATTGAAAGTTACAATACATCCAAATTTCCCTTTGTATTTTTCAA
TACATTCATCCATCTTTTTGAAAACTCTTCATACTCGTT
>ERCC-00067
+GGGAATTC
GCCGTACTTACACCCTACGTTGCTGATCTCGGCGCTCGTACATTTACACTTGTAGTTGAA
GGTCGGGCGATGAGGCGTTCGTTTGGCCAACCTCGTTACATTGCACAAATGCCGGATTTG
GCTACTATATATACTCCCTGATCAAGGGTCGAGTTGTCTGTGCATTAGCTCGGAGCTAAT
@@ -616,6 +661,7 @@
CGTGCGACGACAAATTACCGAGGGAGGCACTTATGAGTTATCTTCGCTGTGATATCTCCT
TCGACTAGCGCGGTCAGTCC
>ERCC-00069
+GGGAATTC
GGGAGAAGTACCAATATCAGACTCCCGAGACATAAGGGGTGTGCACGGCATGGATGTGTC
GCTAACCTCCTGGTCCTATAAAGCAACACTCATGGCACCGTGTGCTGAAGGCTCCAAACG
GGTCGATACCAGAAGGGTCGATTCTTTCTTCCAATACATTGTCGGTGTCAATGCTGGAGG
@@ -636,6 +682,7 @@
TCAAATGGCGCGCTGCCATACAAATCCGGTTCCAAGCATGACTCATGGGCAGTACGCCGG
TTAGTGGGAAATACGGCTGTCAAACGCTGGTCC
>ERCC-00071
+GGGAATTC
CATGCGAGAGGCCTTGAGCCGTTGGCCGATCGCATACAGAGACTATTGCATCAAGGTAAC
ACTTATTAATCCCCATCGTCATAATCGCTAGATTCTAGGTATTTCGGATCTTCCTAGTTA
TCAGAAACATGTTAATTGGGCTCGGGCGTCTGCGCCAGGCCTTCGTAGTCCATACCACGA
@@ -648,6 +695,7 @@
GACCTGGCCCATTCACTACATAACAGAGTTAAGACTTAGATCAGCGAGCAGGTGTACGCC
CCGGACCTTGGGCTACTT
>ERCC-00073
+GGGAATTC
TGTGATAATTTCGACGAGGCGTTACATATTCTGAGAGGGGTGATTAAGTCTGCTTCGGCC
TGGGATGGTCTGTCTACGTGTGCGTAGTTCTGTCATAGCGTCGAGGATTCTGAACCTGTC
CATAGTATCCTGTAAGCGTCCAATGTACCTATATCGTGGACCCAAAGTCGATACGTCCGA
@@ -659,6 +707,7 @@
TGCAAAGTTACGTCGCATTCTCTCACGTTACGGCTGATTCTCTAGGCTTACGCGCATGAG
CTCTAGGTTCCGGGTACTATCGAACGTGTCATTGGTACT
>ERCC-00074
+GGGAATTC
TGGACATTAATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGG
TTTCCTCCTATGGTTTTCAAAACAATCACCATCATGCTATTAATGATATTAAAATCCCAA
CTATACCAAAGAATATCCCAATTATCCATAAAACTGTAACTAAGTGAGGCTCTCTCATTG
@@ -669,6 +718,7 @@
GAAAAACCTTTGCTGGATATTTGTTAAATATCAATAGCCCTAAATAGGATGCAGAGAATA
TCAAAGCGGAAAAAATCC
>ERCC-00075
+GGGAATTC
TCCTACACGTTCCCTCATCTGAAACCATACAACTACCAACTGGATTTAATGGAGTGCAAA
CCGTTCCAAACAATGGGCAGTCAGTTGGCAGTTTCTCTCCTCTCAAAATCTTATCACATA
TACAACCTTTAGGAATTTTCTCTTTAATCTCTGGAATATCCTCATGCTCATAGATGTCAA
@@ -687,6 +737,7 @@
CTGGCAGAACATCCCTAATCCCATACTTACAGATCGTGTGCTCATGACTTCCACAGACGT
GCATAATCTTTAATTTATCTTCTTCTCAGCAAGTTTGTT
>ERCC-00076
+GGGAATTC
CTCCTCATGTGAGCGGATCACTATCTACAGCTGGTAATACTCTCAGAATTTCTAACTACC
AGTCGTAAAGTAGGCGAGCGTTGGTTGGTTCCTCTTGAAGCGAGAGAACCAAGGTGCTGG
CTATTGTCCGCCCCGTCTACGGCTAACGCGGGGTTCTGCCATCCCGGTTTAGCGCAGAAT
@@ -699,12 +750,14 @@
TGTATGTTGTCGCCACTCTCGCACCGTTTTTATAGTCGTTCTATTAGAGATGGTTGCACA
TGGGCGTTTCTCATCGGT
>ERCC-00077
+GGGAATTC
AGTTTTTTCACCTTATGACTTCTCACTCCATACGAAAGACAGATGGTTTGCTCCCAATGA
ACCCAGAGGGAGTTAAGGTTGATGATTCCCAAGTCCAACATGGAGTTATGCCTATAACGT
CATGTTGGACAGACCCCTGTATTGAGCAGACTTAACTTATACTGATATACAGCTAAAATT
TGAACAACAAATCTCTTAAATTTATTGTTGAGAATAAAAAGGATACTATCTTATCCAATA
TTGTATTTCC
>ERCC-00078
+GGGAATTC
GGGGAATTGGATTTGCAGAGCATATTAGCAAGTTAACGCCGATCACTCTCCGGCAGTTGC
TCCATTAAATACGGGCCTTCGCAATCGCGTGTTGTTACACATAATGCCGGTATCCATCTA
CTATCGCCGCCAGGTGCAAGAAATGCATATCCCGGCCTACCCCCTTAGCAATCGACATTT
@@ -723,6 +776,7 @@
AATGAACGGAGTGGCTGGCCCATAATTTCGCACCCGAAGCTACTGGTCGGACCCATCAGC
GCGTGTCGT
>ERCC-00079
+GGGAATTC
GATGTTGGAGTTAACGGAGACCCGCCATCGTTTACGAAACAGGTCGCAGATAAATGTGGA
GCAGATTTACGTTGAGGGCCTTCTGGGGACCCAAAGGATGAACGGGGTGTTGTTTCAGAG
CGAATAGAGCGATCACCAACGCGCACGTCTCTTTTTAAGATTGAGCGGCTAGGTGTTTCC
@@ -735,6 +789,7 @@
GCTTCCACCAGATACTCCCCAGGACAGGTGGAGATACCAACCACGAAGGAGGTCTCGTGC
TGAGCCTTCGTCGATATACC
>ERCC-00081
+GGGAATTC
TTTATGCGGGGTGTTGTTGATAAGACTTCCTAGGCACGCGGACCAAGCACGTTAAAGGGA
GGTTCGCTCGATCAAGAGATCCATACAGCAGGCTCCTATCAGTCTATCTGACGCCAGTTG
CCATTGGACGGGATGTCGAGGGTTTGCGGTGGGGAACGACCATACTTACTGTCATTACGA
@@ -745,6 +800,8 @@
GGCGACCCTCTAGTTGCACGCTGGTACATCAGACACGTACACACGCGCAGTGGGGTGTAA
TCAAGCAGGACCATAACTGATAGTTCACC
>ERCC-00083
+GGGAATTC
+GAGCTC
GAGTTTATAGTCTTTTTTTGATTGCCTCAACTAATGCCTCCTTTGTAGGAGCTCCAATAA
ACTCAACATCCCCATTTATTACAATTGTTGGAACTGCCATTATCCCATATTCCATTGCCT
TTTGAGGATTCTCCATAACGTTTATGTATTCTACTTCAACAGCATCCGGCATTTCATTTG
@@ -763,6 +820,7 @@
CCATTTAAATCATTTCACAGTGTCTTTTTTCTTCGTCTAATGTTTCATAGCCTTCTGGAA
TTTCTTCCTTTGATTTTGCCATTTTACAGCGACAAATGG
>ERCC-00084
+GGGAATTC
GCGAATTGTCTGGGGCCTCGTTGTGACTATCCTATTACGGGGATCTCAGGTGTGGTATCC
CTGGTTGAGACATTGGACTAGTGTAATTGACAGTCATCGTATGCGGGATACCTCAAGTTG
TATTCGAGGGCTTATCGGTGATACTGTGTAATCCCTTCGGCGAAAGATGTATGCGTGAGC
@@ -781,6 +839,7 @@
CATACGGTCACTGGGGCATTTGCAGTGAAATTAACCATCCCCGTTCCCGCTTCTCAGTTG
CAGGGTGGGG
>ERCC-00085
+GGGAATTC
GATTCAGCCTGACGTACATAGACGAGATAGGGTAAGCCTATTGCAAACCTCCGCTTTGCT
ACTACAAGGACCTCGGAAGTGTGGAGAATCGAACCTACAATTTTGCCAGGATCACGCCGG
TTATCTCTTGCAATTCCTAAGATGGAGGATAGTTTTGGAACCCAATATCCCCAGCCTACG
@@ -796,6 +855,8 @@
TGGGGTCGTTCTGCCCGAGTGCTGCATTCCGCCTACGCGCGGTATTCAACAAGGGTAATC
CCTCCGACAACCCTCAGTGTTATCATCCGCGTCAAGGGGG
>ERCC-00086
+GGGAATTC
+GAGCTC
TTTCTCTTGACTTTTTCCATAACTTCCCTAATTGTTCTATAATTCTCTTTCAAAGAGTCC
TTATCATAACCAAATACATAAACTCTAACTCTATTTCCTTTTGATTCTATTGTGCAATCA
ATGTCCATCCTTGATAATCTCTCACAAAGCTCCAAAAGCTCTTCATCACAACTCACTTTT
@@ -814,6 +875,7 @@
AGATGAGTTCTTCAAAAGGGAATTTTATAGCTGTTGATGACTCTCCAGAAGAGATTAGGG
CTAAGATAAAGAAAGCATACGCCCAGCTGGAGTTGTTG
>ERCC-00092
+GGGAATTC
AGATGTATATATGATGTCCTTGGACGGGGTGGCGCAGTATTACTGCAAGAGAGCGGACAG
ATTAGTGTGTTGGAGCCGACACATCAAAGGTTCGTCCGGGGACCGATCTGCAGCCTACGG
GACATTTATCCGTAAAAGCATGGCGCTGTTTCGTACTTATCGGAGGCCAGGTATCGTCGC
@@ -834,6 +896,8 @@
AAGGCAGATTAGTGCCCAGTAATTGCGTTTTTTTGTCGTTGTCGCAGAACGCGATTTGCT
CCGAAAGCTTTAAGCCGTGG
>ERCC-00095
+GGGAATTC
+GAGCTC
TTGATGATGATACTTAACCAAACCTACCACTAATGTAGTCATCTGTCTCCTTCTTCTGTG
GATTTAGGAATATCTGCTCTGTCTCTCCAAACTCAATTAATTTCCCCATTAAGAAAAAGG
CAGTGTAATCAGAAACCCTACTTGCCTGCTGCATGTTGTGGGTAACAACAACAATCGTAT
@@ -844,6 +908,7 @@
TATCCTTAATTCCATGAATTCTTGGGCCAAATGCAACATTATCATAGATGCTCATAGCAA
AAGGATTTGGTTTTGAAAT
>ERCC-00096
+GGGAATTC
AGATAAAACGAATAGCTCGTAACCAAACATGCACAGCGGTCAAACAGTATGTCCCAAGGG
GACTTAAGCGCGGTGGCCTCCCCTATCCCCTACGAGGCTACCCGGATCGATGACGCGAAT
TGGGGACATTCAAATGAGCATCCTAGTCACCGCGTTTAAAATGAACCTGCCGGCTGATCG
@@ -864,6 +929,7 @@
CTATTGCCGAGATAGTATTTCTTAGCTTCCTGAGGGAGGTCAATTTGAATGTGGTTATAT
GCG
>ERCC-00097
+GGGAATTC
CCTTCATAATACCACCAAAATACCAATTCGAAAGTTTTAGCATATTCAAACAATATAAAA
TCTTCAGATTGGACATTAATTGGGACTGAAAGTCCCAACTTAATGGACGTGTGGTATCCA
CACCATAAAGGGGCTACGCCCCTCTTGGGATACTCCCCTAATATTGCTAATTTACACCTC
@@ -874,6 +940,7 @@
TTAGCCCCCCCTCTTGGGTCTGGTCTAATTCCAACAGTTTCAGCCAACAAACCAATAGCA
TCAAACCCATGTCATGGC
>ERCC-00098
+GGGAATTC
GGAGGTCGCAATTACATCGGTTCCTGTCCCGTAGAGGCTGGAAGGGGCATAAGAAGCAGT
GATACCAACGCTCTCCCCCGCGCGTCTCGTGAGAGCAGACCATGAACATCGCAGAGGAGA
ATCCTGCATGACTGAATGCGCAGAGCAACTGTCACCACGTGGTTAATGAGAAGGCAGAAC
@@ -894,6 +961,9 @@
CGACCATGCCAAATATCAACTCAAGGACAAGTTGACGCCTGCCTTCTGGGGTATGGATCA
AAAGCCCACGTTACCATGTAAGACCGTGTGGATTTTCG
>ERCC-00099
+GGGAATTC
+GAGCTC
+GGTACC
GGGGATGCAAATGAAAGAGGAGACATTTTATCTTGTCCGTGAAGATGTATTGCCCGATGC
AATGAGAAAAACATTAGAAGTCAAAAAGCTGCTTGATCGAAAAAAAGCAGATTCAGTAGC
AGATGCCGTTCAAAAGGTCGATTTAAGTAGAAGTGCGTTTTATAAATACAGGGATGCTGT
@@ -918,6 +988,8 @@
GCAGGAGCTCGAAGCACTCGGCTGCAAAGTGAGGCTTCTGGGTGCATACAGTCTTACCAA
TTAT
>ERCC-00104
+GGGAATTC
+GAGCTC
TGCAATCTCTTCAACAGCCTCTGCTAAGTATTCTGCAGCTGCTCTGCTAACTCTCTCAGC
ACCAGCCTTTTTCAATATTCTCTCAAATGGTGCAACTGGAAGCTCAGCCATAATACCACC
TCACAATAGATTTCCAATAAATACTGTTATAAAATCCTTTATTTAAACTTTTCGGTCATT
@@ -953,6 +1025,7 @@
TCAATGGCTTTATTATGTGTTCGTCCAACTCTGTTTCTGTCTTTTCGGTCAATGGAATTA
GGTAGTGTTCAAATATCCC
>ERCC-00108
+GGGAATTC
CTCTGTGTCATGATCGTGAGTTGTCGCAGTGTCTGTACCAATACTCTGGTGGAGCTATAT
AAGCCGCTGTTGCGTAAATCAACGGCATGATCCCTATGACCGCGTCATGCTAACTGATAC
ACGCTGCTCGAACAGTGATACGCACACTGATAACTATGCGCAGACGCTTGAAACGATGTG
@@ -971,6 +1044,7 @@
GTCCGATGCTCTGATCTACACTGCCGTGATCGTTATATGACGAGACTGTGCGCTCATAGC
CGACACTGTGCTCGATAAGACCACGCTGTGCGGATAT
>ERCC-00109
+GGGAATTC
TAGCGGAGTGTCAAATTTCGGAAGGGGGCCATAATGTTTCTTTACAATCGCACCAGTTAG
CGTGGCGTATACCATGTTGTTAACAGCGCCATAAGTGCCTGATCCGCGGGCAAAACTACG
CAACACTGTGACTGGGTGCTAGGTCGACGAACAACTGACGCAACTAGATCATGGGAGTGC
@@ -981,6 +1055,7 @@
CTGAGAGATCGAAATAGCCTCACCCTTGAACCTACAAAGCTCACTTTAGCCCGTTAAGTT
GTCGAAATCACTAGATCAGAAGTCTCCCACTC
>ERCC-00111
+GGGAATTC
GCCCTAAGTTCCGGTCCGCAATTTCGTTTCGTTGGGACGCTTGAAGCGCAAGTAGAAAAC
GAGATAGGGTGTCCCATCTAAACCGCCGTGCCAATAGCTTTAAAGGCCAGGAAACATTTA
ATATCCCTAACAAGCACGGTCCACCAACGGCATTACGACTTTACGAGTTCGCAGAACAAA
@@ -999,6 +1074,7 @@
CATAGTAGAATTAAGCGAGATCCATGACGTCACCGCTACTCAATCATCATCCACGTCTCG
CGTCATACCC
>ERCC-00112
+GGGAATTC
AGATGCCTGGATAGGTTCAAGTTACGTTTACACCGTTCCCACCCCACTAACCACGACCTT
TCTCGCCTTTGTTTTACCAACGCCGGCTAACAGGTCGGGCCCAACTAATATTGTTAAGGC
AGGCGTTCTGTACTTACTCGATCGTTCATAGCCCCACGACATAGTTTTTAGTCATTACGT
@@ -1019,6 +1095,7 @@
GACGCGTCTTGGACGTAGTACTCTGCAGTGCCTAAACTCATAGTAAACGATCTGGTAGGT
CCTTTTACACACGGTTTTTATCGCTTAGTGCT
>ERCC-00113
+GGGAATTC
ACACCGGCGCACGCCACAGGCGTCATACTTCCCAAGAAGCGGCCATAGCCCAGATGCGAG
GTGGAAAAGTCACACTAGAGCGACACCAACATCGTTACGCTTACACACCGGACGCTTGGA
TCAGTGGGAAGTGCTCACGCGCGGAGCCCACTGGGCGAACAGCAACGTTATAACGGCCAC
@@ -1034,6 +1111,7 @@
ATGGACGATGACTATAGTGTAACAGGTGCAGAGCTTAACTTTGGACACATGACACTCAGT
TCTGTACCAACTAGGAAGAGCGCCGGGGTAGAAGAAT
>ERCC-00116
+GGGAATTC
AAGCGTTCACAGCTCGGCAATACCTGTGACGAGCTGCTCGCAAGATTTACGCAGTGTGGC
TATACTTGACAGTGATGGCGCTTACTTCAGATGTATGGGTGATACTTCGCTATATGGGTG
GTCACTTCTCTATGGCGCGTGACAATGTACTATGGAGCGGTCAATGTCAGTACGGATCGC
@@ -1068,6 +1146,7 @@
GACAGCAGCTCAGCATCTATGCATCATGTGCCTCACTAGGACATCATGCTCGACTCTGAG
ACACTGATCGAGCATTAAGACTCTAGAGCGGCCGCCGACTAGTGAGCTC
>ERCC-00117
+GGGAATTC
AGATACTATCAGGCGCCTATGGGCAAATCTGGCCTCCAAACTCCGAGTGTCACCGAACCG
TAGGAAATTCCTTCCCCAAGCGTGTGCAATACTCGTAGCACACCGGGATAAATAGGAAGG
AAACATCCGCGGGTCTTACGGTGAAGCTGTGGGACCGCTTCTGTACACGGCGTCCAATCA
@@ -1088,6 +1167,7 @@
CAAGGCTTCCTATGAGTGATTCCAAAGAACATTGCCCGACGACCGAGCCTTCAGGTAATC
CACGAGACATATGCTAACCAGTGGTGCCATGG
>ERCC-00120
+GGGAATTC
GGCGTCTCACCTGGCTTGATTCAGTTAATGGAGCACTTGTGGGAGTGCCGCGACACAACA
TCCGCTAGCCTCAGTCGAATGACAAGTTAGAACAGGAGTGGGGCCGATCTCTGCAAACTC
CTATTGTCAGGGGTGGTGGACGGTATAGGGTTTTGCGCCTACCTGAATGCAAGGGCTTAC
@@ -1098,6 +1178,7 @@
ACCGCGCGAGTGACACGCGTTGACGTTACATGGTAAACTCGTAGCCAACCTTAACATTCC
CTGCACTATGTTAGTGCGTACAACATTAAGGG
>ERCC-00123
+GGGAATTC
TTAAGAGAGGAATAATTACTTTTTCATCTTACCCACCAAGTTTTAGTTTTCTTATTCTTT
CACTTAATTTTTCGACCTCCTCCTTTGTTAATCTTGTAGCTTTTTTAACCTCCTCCAATT
CTTTTTGTAACATTATTACTTTAATCCCCAGTATTATGTTGAGGAGTATGCTAATAGCCA
@@ -1116,6 +1197,8 @@
TGCAAGAGCCACAGCAAGATTTGCAGATATCGTTGTCTTTCCAGTACCTCCTTTTCCAGA
TGCTATCGCGATAGCTATTCCATTAATGTCACCATTCT
>ERCC-00126
+GGGAATTC
+GAGCTC
GGAGACCGACCGCGCATTAGTCAATCATATAGTTCGATAAATGAGACGTCACGGATTTGA
GTATCATTTGCTAGAACTGCTTACCTATCTAAACGCTCAGGTATGCCTGCGCTGAGACTC
AGCATCTCAATGTGACCGAGCTTGTGACTCCGCATCCTCCTGCAATATACCCATCGGCCC
@@ -1136,6 +1219,8 @@
GGTACTCCTCGACTGGGTGCCATATGGGCTACTGGCGAGAGGAAATTTGCTTTTGTGTAT
TTAGGCCCGTGGCACCT
>ERCC-00130
+GGGAATTC
+GAGCTC
GCATTTTGAAAATTCTATGGAAGAGCTAGCATCTCTGACGAAAACAGCAGACGGAAAAGT
ACTGACCAGCGTCACACAAAAACGGAACAGGGCTGACGCCGCTACATATATAGGAAAAGG
GAAGGTAGAAGAGCTGAAGGCACTCGTGGAAGAGCTTGAAGCTGATCTCCTCATCTTTAA
@@ -1155,6 +1240,7 @@
TGAGGACGACGCTGCAGCCTTTAAAGAAGCGATTCAGCGCTATTTGCGCCAAGAACTGTT
AACGTCTTGAATTCTGG
>ERCC-00131
+GGGAATTC
CGCCGGATAAAGGCTTCTTCGGTACTATACAAGTTGTCTACGCACATTTGCCTTGGGTAT
TAAACTCTAGTAGGAGCGAAACTTGACATATCAAACCTCTCTGGAGAGGCATCTCCCAGA
CATTACGGATGATCAGGTCTCAGCGAATCCTAGCTGTGCGGATAATTTGTGGCCCGCACA
@@ -1169,12 +1255,15 @@
ATGACCGCAACAGGTGTAAGTGCACCAACTAGTATTGGCTCCTGTCCACATGGTCGGGTT
TTCCGCCCCCAAACATGCAAACATCCG
>ERCC-00134
+GGGAATTC
AGGCTTTGTTATTGGTATTGACTTACAAACAGTTAAGCCATTTGAATATGATAATGTAGT
TGCAATAAAAGGAGATTTCACCTTAGAAGAAAATTTGAACAAAATTAGAGAGCTAATTCC
AAATGATGAAAAAAAGGTGGATGTGGTTATAAGTGACGCCTCCCCTAATATAAGCGGTTA
TTGGGATATAGACCACGCTCGTTCAATAGATTTAGTAACTACTGCCTTACAAATAGCTAC
TGAGATGCT
>ERCC-00136
+GGGAATTC
+GAGCTC
TTTCGACGTTTTGAAGGAGGGTTTTAAGTAATGATCGAGATTGAAAAACCAAAAATCGAA
ACGGTTGAAATCAGCGACGATGCCGAATTTGGTAAGTTTGTCGTAGAGCCACTTGAGCGT
GGATATGGTACAACTCTGGGTAACTCCTTACGTCGTATCCTCTTATCCTCACTCCCTGGT
@@ -1193,6 +1282,7 @@
CTAGGACGCAAATCACTTGAAGAAGTGAAAGCGAGACTAGAAGAACTTGGACTCGGACTT
CGCAAAGACGATTGACTAGTTTCCCTTGTGAACTAGGATTTTCCCGGGTAC
>ERCC-00137
+GGGAATTC
CAAAGCAAACCTAATGAAGCCAGACACGAGATCACAGAAAATCGCTGACTATCCCGAGTG
CGCGGCGAGCTACAATCCAAGATGATTATTTTTTCACGACCGGGCGCTGGTCAGGTATAT
CGCTGGTACAGATGGCGGCAAGCATCGTTGTCACCACTTCCTTCACGATTTCCGTTAGAG
@@ -1203,6 +1293,7 @@
GCAGGTCACATCCCCCTGGTTAAATAGAGGCACGAGCGCTCGTTTTTGGGTGATCAATAT
GGCTTACCCCCGAGAGAGTTGTGAGCTTGCACG
>ERCC-00138
+GGGAATTC
CCTGCTAAAAGAGGTTGGTTGTATAAGATTTGGAGAATTTATCTTAGCCTCTGGTAAAAA
AAGTAACTACTACATAGACATAAAAAAAGCCACCACAAACCCAGAAATTTTAAAGTTAGT
TGGAGAAATTATTGCTGAGCAAATAAAGGATGAAGATGTAAAAGTTGCTGGAGTAGAGCT
@@ -1221,6 +1312,7 @@
ATCCCATCAACACTCATCCAAGATAAAAATCCTCTCTGTGGAGTAATCATAATAGATGGG
AACAAATTACTCCTTGCCCTTCATCTGGTGTTTGGAT
>ERCC-00142
+GGGAATTC
CACCTGTCACATTTCCAATCGGCTCCAGGAAGAGAGAAGTGACGGCTTGATCCTGTAGTA
ATCCGGGATCGACTTAAGGGGTGCAGCGACCACGGCGGATCGGGCGTCGCAATAGTCCTC
CTGTTAGGAGGGTCCTTCTAATGTTAACGCCCGAATATTAGTCATATTTTGCTAGCGCCT
@@ -1230,6 +1322,7 @@
GAGACTTCGCCTCCACACACCGGAGACCCTAACCGTACCCAAATGTAACTAGCGCCTCTG
GTGTGAGCTTACTAGAAAGTAGGCCGGGCCGGTCGACAGGAGGTTGCGCC
>ERCC-00143
+GGGAATTC
ATGCAGCGTAGGTATCGACTCTCACTGTGGAGTCGTCTATGATGTCGTGGAGTCCTCTCA
GAGTGCTGTAGGTCCTCATAGGTCGTGCTGTCTCTCTACACGCGTGCGTGAGTCTACATT
TCTGCGAGTTGGTGCTCTCACTGCGGTGTCAGTGATCTCTCCGCGTGTGACATGAGTCTA
@@ -1244,6 +1337,7 @@
ATCTACGATCCTCGCTAAGTATTCAGCCACCTCGTATAGTATTCGCGCACCTGAGGATTT
ATTCACCTGACTCGCGTATAATATGCCGTCACCTAGTCT
>ERCC-00144
+GGGAATTC
AGCTAGGATAAATTGACCCGTATGAACTGTTGCCGGCTCGGAAATGTTAAGGCTCTGCGC
ACGCACTTTATCATTCGCAGCCTGTTCTGTCAGCGGGTCAGCCTAGGTTACGGTGGAACC
ACTCGGTATCGTGCAGACAGGGATCGTAAGGCGATCCAGCCGGTATACCTTAGTCACATA
@@ -1254,6 +1348,7 @@
ATCGAAATAGCTTGGACTAATGTCCGGCACATAATCAAGTCTACATCAATCATGAATGGT
TTCTGATTTGCTACCATCAGATATCATGTGAGC
>ERCC-00145
+GGGAATTC
ACTGTCCTTTCATCCATAAGCGGAGAAAGAGGGAATGACATTGTTCTTACACGGCACAAG
CAGACAAAATCAACATGGTCATTTAGAAATCGGAGGTGTGGATGCTCTCTATTTAGCGGA
GAAATATGGTACACCTCTTTACGTATATGATGTGGCTTTAATACGTGAGCGTGCTAAAAG
@@ -1272,6 +1367,7 @@
TTGGATCGAACCGGGCCGTTCTCTCGTGGGAGACGCAGGCACAACTCTTTATACGGTTGG
CTCTCAAAAAGAAGTGGATAAGCTGTACAATCGTTTCATCATTCGGCGTGCGAATT
>ERCC-00147
+GGGAATTC
CCTTGCTTAACCTTAATCTTGCCTTATTACAATATTTTTAGAAAAATAAAAAGTAAAAAT
AAAAGCAAATCCTTAATCTTTGGTGATATTGATGGAGAGGTATGAAATCCCTAAAGAGAT
TGGAGAAATAATGTTTGGCTTGTTGTCTCCAGATTACATAAGACAGATGTCAGTTGCTAA
@@ -1290,6 +1386,7 @@
TCTGTTGCAGTATCACGTAAATACCTACTTCGATAACGAAGCTCCAGGTATTCCACCAGC
TAAGCACAGAAGTGGAAGACATTAAAAACCTTAGCTCAG
>ERCC-00148
+GGGAATTC
CATCTCCATTTGGTCACGTTTACAACCGGAGTAGACGGCCATAGCAGGAGGGGTGTGCGA
CAGGCAGGAAGCTCTCGCGGGGTCCAAGCATTGCTGCAATGGGCGTCCTTGCTCGATGTT
GACCCGAAGCTCTAACTGCATTTCAAGTCCGAATCTCTAGATATCTCGAGAGCCAATGGT
@@ -1299,6 +1396,7 @@
AGTAGACCTGGCGTCTACCCCTCCAAACGCATTCTTATTGGCAAATGGAAGTAGCTTCCA
CAGTTTGTAACAAGCCGTGCCTGCGCATGTTATTTACCAATGGAGAATCG
>ERCC-00150
+GGGAATTC
AGCTTGATGTGACATCACGTCCCAATCAATTTGGTTTTACTCCCCTCGATTATGCGGAGT
TATCAGTAAGAGCGGGTACCGTTCTGCTGAATGCACTATGAGGGCGACCCTTGATCTTCA
TTCGTTCCATAGATGCAAATACCCGGGTACTAGTTGGCGAAGTTTGGCTAAAGATTGCCC
@@ -1312,6 +1410,7 @@
CAGAGGAGGCTAGCTCGAGGTCACCCATAAGGGATTACGGAGTTACACCCATAGTAACAG
ACGGAAATTGTTGATAACAGATAGTTAATACGCCTTGGCTGAGGAGACCAACGGACTTC
>ERCC-00154
+GGGAATTC
TCACTAGATCAGAAGTCTCCCACTCGAGACTAATCTTGGACTATCTATGAGCACCTATTG
CGCTGTGGAAGATTGCCCCTAGGTCTCTGGCGGCTCCGATTGCGGGATGAACTGGTTGGT
CCGAGGAGGCATATAGGAAACGATGGGCACGCGCTATTCAGACGTTATTTGGTATGGAGT
@@ -1322,6 +1421,7 @@
GGCTGGACCAAGCAGCCGAGGCTGCGCTCCGGCATCAAAGTCCACGAGTTACAGCCAGCG
GGTTTTAAGGGGGTATTAGCATCTCGAGTGAGT
>ERCC-00156
+GGGAATTC
CACAAGAATCCCTGCTAGCTGAAGGAGGGTCAAACTATAACACCTTTAGCATTCGTACAG
GCAGGCTAAGTGAATACTAACCCACCGGCAGCCCGTTGTAGTAACGTTGACCCCTGGCTC
GGAGACATTTGGTGTTGCCTAGTACTAGGTGACTGGTACCGATTCATAGGTTCGCCATTC
@@ -1331,6 +1431,7 @@
GGCGGTGTGATCTAGCCTTCTCGCCATATGAGGGCGCTGAGCATAGACCCAAACCCGACT
AGTCGAATCTTAGGGTTGTATGCTAGAACGGCATGGTATAAGCCGTGCTC
>ERCC-00157
+GGGAATTC
GGTCTTTGTCACCTCCGTCAATTTGTATTAGAACCCGTGAAGGCCCAAGTAACAGGCCCA
GGGTTAACATGTACGGAACATACTCCTTCCACGGAAGATTGGGGATGAAAGTTGATACCC
AAACTTCATTAACACAAAGGCGATGTGGGCCGAGTACTGTGCTTACACCAACAGGGCGGC
@@ -1349,6 +1450,8 @@
AGGCGGTCACAGCAAACCCTCAGTTTACCGGTTCGATGATTATACGATGCCGGAGCGAAC
GACTACGCTCGAAGTTTGGTTATCTAGAGCACGTC
>ERCC-00158
+GGGAATTC
+GAGCTC
TTTCAACAGATCATGGAACTACGGGAGAAATAAACATTTGGATAGAAAATGTAACATTTA
AAAATGATGCAAAATCATATTCCTTTAATTTAACGAATCTTAATATATGGGCAGTAAATA
AATCTGCTTATGAGTTGTATTGGAATCCATTTAACAAATCTATCTGGATAGATGGGAGTA
@@ -1367,6 +1470,7 @@
TAAGGAATAATAAATAAAGTTGGGGGATGATGATGAAGAGATTTGCATTACTCTTTATTT
TCCTTGCATTTATAACACCACTTTTGCAGATGTTGAGG
>ERCC-00160
+GGGAATTC
TCCTTGGTTTGAAATCAAATTACTATAGATTGCATGCAGAAGTAGGGCTTTACAAGTTTG
TTCCTAATTCCGTTGAACAATAGCGAATGTATGATGGTCGGTCATTGCCGCAACCCTGAA
GCAGTGAGCGTGGTTGAGTAACCACGTACTAGAAGTCCAAGGATGGTTGCAGTAGCTAGC
@@ -1380,6 +1484,7 @@
ACCATGATAACTACTGACTGCGCAGTTGTAGCGACCGCAATGGGGAGTGTGTGTTCTTTA
TTTCAACTGCGTGGCTTATCCTACTTAGGAGTTGTGGATACCAGATTATCTCGCGGTGG
>ERCC-00162
+GGGAATTC
CTCCACAGATTCCCATGTGTCCAATTCTGAATATCTTTCCAGCTAAGTGCTTCTGCCCAC
CAGCAACAACTATGTTGTATTTGTTGCTTAATATACCTCTAAATTTGCTATCTTCAATGC
CTTCTGGATATTTTGCTGATGTAACTGTTACTGACCTTGCCCTCTCCTTGGCAAACAACT
@@ -1390,6 +1495,7 @@
CACTGACTGTTATTGCAGCCAATCCTGGTGGAGCTGCCAAACATTTTTGAGAACCAGTAA
CACAGATATCATGTGGAAT
>ERCC-00163
+GGGAATTC
ATAGACTAGCCTGCCGGTCAATAACTGATGACGCGGAGTCAACCTGATAACCCATAGCGG
AACAGTCTAACCTACGCGAGATACGTCTTACCGCACATAGGTAACCTATTCGTGACTAGC
AGGCCTTATTCCGGTGCTATGAGTATCTTACCTGGTCTAGGTATCTAATTCGTGGGTCGG
@@ -1400,6 +1506,7 @@
ATTTCGTGAATACTGAGCCGAATATCGTAAGACACCCGCGAGCGACTGTAAACTAATCGG
GGAACTTATTATAGGGCCGGTCCAGGTCTTGAACGACGT
>ERCC-00164
+GGGAATTC
AGGAGCTCCAGTAGTTTTCCCCTCAAAAATTCCTGATAAGATTTCAACTTTATCCTCTTC
TTTTCTTGGTGTTGAGAAGATGCTCTGCCCTGGTCTTCTCCTGTCAAGCTCTTTTTGGAT
ATCCTCTTCAGATAAAGGCAGATTAGTTGGACATCCATCAACAACTGCTCCAACAGCCTT
@@ -1418,6 +1525,7 @@
ACTCTTATAAAGGTAGCATTTGTTTCTGTAGCAACAGCTTTAGCTAATAATGTCTTTCCA
GTTCCTGGTGGCCCGTAAAGAGAATACCTTTTGGTGGTT
>ERCC-00165
+GGGAATTC
GATATGCGTTACGTGAGTCTGATAGCAGTTCACTACCTGGATATCTGATCCACTAGCTCG
ATCATGCTCACCCATAGTTTATCTGCATCACTCGTACTGAAATGCTCACATCGCAGGTAG
AGCAGCATCGTAGAGCGTCAAGCTGCATCCTAGCGTCATGAGTCATAGTACCTCATGCTC
@@ -1434,6 +1542,7 @@
CTGCGTGTCTTAGAGCTTATCGCCATGTCTGTCAACTGTACTGTCATCCTGTAACTGTAG
CGTATGTG
>ERCC-00168
+GGGAATTC
CCAATGAACTCAGCTATTCTTCTTAACAAATAACTTTCTCCAGAAAATTCAAATGTATCA
TCTTCAGGATTCCACCTAAAAACATCATGTAATATAATATCATCAATTTTTGGGTCGTAT
TCAACAATCTCAGTTATACTCTCAGTTCTTCTAACAAATCTTCCTTTATAAATCAATCTA
@@ -1452,6 +1561,7 @@
CTATGAAACACATACACTGGCTTTCCAACACCTGTGCAACTGATATCCTCCAAATTCTCA
TCTTTCATAAGAGCATCTATTTCCCATATCCAATGAGGT
>ERCC-00170
+GGGAATTC
TATTGGTGGAGGGGCACAAGTTGCTGAAGTTGCGAGAGGGGCGATAAGTGAGGCAGACAG
GCATAATATAAGAGGGGAGAGAATTAGCGTAGATACTCTTCCAATAGTTGGTGAAGAAAA
TTTATATGAGGCTGTTAAAGCTGTAGCAACTCTTCCACGAGTAGGAATTTTAGTTTTAGC
@@ -1470,6 +1580,7 @@
CTTCCTTCCTGTGTTCCAGCTACAAACTTAGAAACAAGTGGAGCTGAGATTACAGCAGAG
AATATTGAAGAACTCATTCTTTAGATAATGTCTTAGGTT
>ERCC-00171
+GGGAATTC
CTGGAGATTGTCTCGTACGGTTAAGAGCCTCCGCCCGTCTCTGGGACTATGGACGGGCAC
GCTCATATCAGGCTATATTTGGTCCGGGTTATTATCGTCGCGGTTACCGTAATACTTCAG
ATCAGTTAAGTAGGGCCATATGCCTCGGGAATAAGCTGACGGTGACAAGGTTTCCCCCTA
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
You can’t perform that action at this time.