-
-
Save codecademydev/75924f7ccc7198a32cb5a455b8475b82 to your computer and use it in GitHub Desktop.
Codecademy export
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
sample = ['GTA','GGG','CAC'] | |
def read_dna(dna_file): | |
dna_data = "" | |
with open(dna_file, "r") as f: | |
for line in f: | |
dna_data += line | |
return dna_data | |
def dna_codons(dna): | |
codons = [] | |
for i in range(0, len(dna), 3): | |
if (i + 3) < len(dna): | |
codons.append(dna[i:(i + 3)]) | |
return condons | |
def match_dna(dna): | |
matches = 0 | |
for condon in dna: | |
if condon in sample: | |
matches += 1 | |
return matches | |
def is_criminal(dna_sample): | |
dna_data = read_dna(dna_sample) | |
codons = dna_codons(dna_data) | |
num_matches = match_dna(codons) | |
if num_matches >= 3: | |
print "There are %s matche(s). The investigation continues" % num_matches | |
else: | |
print "Number of matches: %s. Suspect can be freed." % num_matches | |
is_criminal("suspect1.txt") | |
is_criminal("suspect2.txt") | |
is_criminal("suspect3.txt") |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
ATCGAAAGCACAATCATGCATCGTGCCAGTGTGTTCGTGTCATCTAGGACGGGGCCATAGGATATATAATTCAATTAAGAATACCTTATACTACTGTCCCCTGTGGTTCGAAGGGGAACTATTTCGTGGGGCGAGCCCACACCGTCTCTTCTGCGGAAGACTTAACACGTTAGGGAGGTGGAATAGTTTCGAACGATGGTTATTAATCGTGATAACGGAACGCTGTCTGGAGGATGAGTCTGACGGTGTGTGACTCGATCAGTCACTCGCTATTCGAACTGCGCGAAAGATCCCAGCGCT |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
CCGTAAGACAAATAATTCAATAAAGATGTCGTTTTGCTAGTTTACGTCAAGGTGTCACGCGCCATCTCTGAGCAGGTGGGCCGACGAGACATTATCCCTGGAGTATCAAACCCGTACAAAGGGAACATCCACACTTTGGTGAATCGAAGCGCGGCATCAGGATTTCCTTTTGGATACCTGAAACAAAGCCCATCGTGGTCCTTAGACTTGGCACACTTACACCTGCAGCGCGCGCATGTGGAATTAGAGGCCAAGTTCGATCCCTACACCGACGTACGATGCAACTGTGTGGATGTGACG |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
TCGCATAAGTACAGTAGATCCTCCCCGCGCATCCTATTTATTAAGTTAATTCTACAGCAATACGATCATATGCGGATCCGCAGTGGCCGGTAGACACACCATGCACTTGATTCCGAGGCCTGTCCCGATATATGAACCCAAACTAGAGCGAGGCTGTTGACGTTTGGAGTTGAAAAAATCTATTATACCAATCGGCTTCAACGTGCTCCACGGCAGGCGCCTGACGAGAGGCCCACACCGAGGAAGTAGACTGTTGCACGTTGAGGATAGCGCTAGCTAACAAAGACGCCTGCTACAACA |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment