davfre

#!/usr/bin/perl

# Template for Applied Programming course exercise Day2 Exercise 1

use strict;
use warnings;

my @sampleA = (65,69,70,63,70,68);
my @sampleB = (102,95,98,110);
my @sampleC = (112,115,113,109,95,98,100);

davfre

escape ^Tt
caption string "%?%F%{= Bk}%? %C%A %D %d-%m-%Y %{= kB} %t%= %?%F%{= Bk}%:%{= wk}%? %n "
shell bash
defscrollback 10000
hardstatus on
hardstatus alwayslastline
hardstatus string '%{= kG}[ %{G}%H %{g}][%= %{= kw}%?%-Lw%?%{r}(%{W}%n*%f%t%?(%u)%?%{r})%{w}%?%+Lw%?%?%= %{g}][%{B} %d/%m %{W}%c %{g}]'
vbell off

davfre

Sending one datastream to a unix command is made by piping (e.g. zcat seq1.fq.gz | seqs). These examples demonstrate how to pipe multiple data streams to one *nix command.

Credit and additional examples:

• Thunks 'n things
• Linuxjournal
• http://en.wikipedia.org/wiki/Process_substitution

Process substitution

This works in bash and zsh, but not csh shells.

davfre

use Test::More tests => 15;
use Pattern;
use Restriction;
use strict;
use warnings;

# sequences for testing
my $testsequence0 = "AAAAAAAAAACGATCTAAAAAAA" ; #should not match
my $testsequence1 = "AAAAAAAAAAAGATCCAAAAAAA" ; #should match
my $testsequence2 = "AAAAAAAAAAGGATCTAAAAAAA" ; #should match

davfre

#go to last active window (hit C-b twice)
bind-key C-b last-window
#split windows key bindings
unbind %
bind | split-window -h
bind - split-window -v
#status bar
set -g status-bg black
set -g status-fg white
set -g status-left '#[fg=green]#H'

davfre

The procedure below documents how to install the IBM Tivoli client on the Ubuntu linux distribution. The steps involve unpacking the distributed RPMs, removing and renaming a few files in the resulting folders, and editing and adding a few configuration text files, followed by packaging .deb files for installation.

Adapted from http://adsm.org/forum/showthread.php?21143-How-To-Install-TSM-Client-552-on-Ubuntu-10.04-amd64

Current versions: IBM Tivoli 6.4.0 Ubuntu 12.10

davfre

git cheat-sheet

The git command-line utility has plenty of inconsistencies http://steveko.wordpress.com/2012/02/24/10-things-i-hate-about-git/

A GUI like http://sourcetreeapp.com is often helpful, but staying on the command line usually quicker. This is a list of the commands I use most frequently, listed by functional category:

Current state

git status list which (unstaged) files have changed

davfre

SAM and BAM filtering one-liners

@author: David Fredman, david.fredmanAAAAAA@gmail.com (sans poly-A tail)
@dependencies: http://sourceforge.net/projects/bamtools/ and http://samtools.sourceforge.net/

Please extend with additional/faster/better solutions via a pull request!

BWA mapping (using piping for minimal disk I/O)

davfre

#!/usr/bin/perl
use strict;
my $usage = "cat input.gtf | $! idlist.txt > filtered.gtf\n";
my %ids;

my $FN_idlist = $ARGV[0];
open my $FH_idlist, "<", $FN_idlist or die $usage;


# read id list to memory

davfre

#!/usr/bin/perl -w
use strict;
use warnings;

=head1
Author: david.fredman@uib.no

This script converts a JGI gtf-like file:

scaffold_1	JGI	exon	46078	46218	.	+	.	name "gw.1.597.1"; transcriptId 65742