Skip to content

Instantly share code, notes, and snippets.

@tenderlove

tenderlove/x.txt Secret

Created May 4, 2012 16:15
Show Gist options
  • Star 0 You must be signed in to star a gist
  • Fork 0 You must be signed in to fork a gist
  • Save tenderlove/ddf40b8950c04179ab1d to your computer and use it in GitHub Desktop.
Save tenderlove/ddf40b8950c04179ab1d to your computer and use it in GitHub Desktop.
Download ZIP
Raw
x.txt
[aaron@higgins scaffolder-annotation-locator (master)]$ git reset --hard 0fb5fb6
HEAD is now at 0fb5fb6 Merge branch 'develop'
[aaron@higgins scaffolder-annotation-locator (master)]$ rvm use 1.9.3-p0
Using /Users/aaron/.rvm/gems/ruby-1.9.3-p0
[aaron@higgins scaffolder-annotation-locator (master)]$ sed -i '' 's/~> 1.0/= 1.1.3/' Gemfile
[aaron@higgins scaffolder-annotation-locator (master)]$ bundle update
Fetching gem metadata from http://rubygems.org/......
Fetching gem metadata from http://rubygems.org/..
Using rake (0.9.2.2)
Using rack (1.4.1)
Installing bcat (0.6.2)
Installing ffi (1.0.11) with native extensions
Installing childprocess (0.3.2)
Using builder (3.0.0)
Installing diff-lcs (1.1.3)
Using json (1.7.0)
Installing gherkin (2.4.21) with native extensions
Installing term-ansicolor (1.0.7)
Installing cucumber (0.10.7)
Installing rdiscount (1.6.8) with native extensions
Installing rspec-core (2.10.0)
Installing rspec-expectations (2.10.0)
Installing rspec-mocks (2.10.0)
Installing rspec (2.10.0)
Installing aruba (0.4.5)
Installing bio (1.4.2)
Using bundler (1.1.3)
Installing git (1.2.5)
Using rdoc (3.12)
Installing jeweler (1.8.3)
Using psych (1.3.2)
Installing scaffolder (0.4.4)
Installing scaffolder-test-helpers (0.3.0)
Installing yard (0.8.1)
Your bundle is updated! Use `bundle show [gemname]` to see where a bundled gem is installed.
[aaron@higgins scaffolder-annotation-locator (master)]$ bundle exec rake
/Users/aaron/.rvm/rubies/ruby-1.9.3-p0/bin/ruby -S rspec spec/scaffolder/annotation_locator_spec.rb spec/scaffolder/gff_record_helper_spec.rb
...............F..................F..................FF..................F..............
Failures:
1) Scaffolder::AnnotationLocator relocating a single contig start trimmed with a single annotation
Failure/Error: described_class.new(@scaffold_file.path, @sequence_file.path,
Errno::ENOENT:
No such file or directory - /var/folders/yv/c2r06v597n5bdpw_bf8qcmb80000gp/T/gff20120504-25126-1nv380s
# ./lib/scaffolder/annotation_locator.rb:58:in `read'
# ./lib/scaffolder/annotation_locator.rb:58:in `records'
# ./lib/scaffolder/annotation_locator.rb:18:in `block in initialize'
# ./lib/scaffolder/annotation_locator.rb:15:in `initialize'
# ./spec/scaffolder/annotation_locator_spec.rb:7:in `new'
# ./spec/scaffolder/annotation_locator_spec.rb:7:in `relocate'
# ./spec/scaffolder/annotation_locator_spec.rb:64:in `block (4 levels) in <top (required)>'
# ./spec/scaffolder/annotation_locator_spec.rb:72:in `block (4 levels) in <top (required)>'
2) Scaffolder::AnnotationLocator relocating a single contig reversed with an insert before an annotation
Failure/Error: described_class.new(@scaffold_file.path, @sequence_file.path,
Errno::ENOENT:
No such file or directory - /var/folders/yv/c2r06v597n5bdpw_bf8qcmb80000gp/T/gff20120504-25126-f9ozw6
# ./lib/scaffolder/annotation_locator.rb:58:in `read'
# ./lib/scaffolder/annotation_locator.rb:58:in `records'
# ./lib/scaffolder/annotation_locator.rb:18:in `block in initialize'
# ./lib/scaffolder/annotation_locator.rb:15:in `initialize'
# ./spec/scaffolder/annotation_locator_spec.rb:7:in `new'
# ./spec/scaffolder/annotation_locator_spec.rb:7:in `relocate'
# ./spec/scaffolder/annotation_locator_spec.rb:135:in `block (4 levels) in <top (required)>'
# ./spec/scaffolder/annotation_locator_spec.rb:142:in `block (4 levels) in <top (required)>'
3) Scaffolder::AnnotationLocator relocating two contigs where the two annotations are unordered annotations
Failure/Error: described_class.new(@scaffold_file.path, @sequence_file.path,
Errno::ENOENT:
No such file or directory - /var/folders/yv/c2r06v597n5bdpw_bf8qcmb80000gp/T/gff20120504-25126-1nzqvio
# ./lib/scaffolder/annotation_locator.rb:58:in `read'
# ./lib/scaffolder/annotation_locator.rb:58:in `records'
# ./lib/scaffolder/annotation_locator.rb:18:in `block in initialize'
# ./lib/scaffolder/annotation_locator.rb:15:in `initialize'
# ./spec/scaffolder/annotation_locator_spec.rb:7:in `new'
# ./spec/scaffolder/annotation_locator_spec.rb:7:in `relocate'
# ./spec/scaffolder/annotation_locator_spec.rb:213:in `block (4 levels) in <top (required)>'
# ./spec/scaffolder/annotation_locator_spec.rb:225:in `block (4 levels) in <top (required)>'
4) Scaffolder::AnnotationLocator relocating two contigs where the first of the two contigs is start trimmed
Failure/Error: described_class.new(@scaffold_file.path, @sequence_file.path,
Errno::ENOENT:
No such file or directory - /var/folders/yv/c2r06v597n5bdpw_bf8qcmb80000gp/T/gff20120504-25126-1dkz69t
# ./lib/scaffolder/annotation_locator.rb:58:in `read'
# ./lib/scaffolder/annotation_locator.rb:58:in `records'
# ./lib/scaffolder/annotation_locator.rb:18:in `block in initialize'
# ./lib/scaffolder/annotation_locator.rb:15:in `initialize'
# ./spec/scaffolder/annotation_locator_spec.rb:7:in `new'
# ./spec/scaffolder/annotation_locator_spec.rb:7:in `relocate'
# ./spec/scaffolder/annotation_locator_spec.rb:235:in `block (4 levels) in <top (required)>'
# ./spec/scaffolder/annotation_locator_spec.rb:238:in `block (4 levels) in <top (required)>'
5) Scaffolder::AnnotationLocator relocating two contigs separated by an unresolved region
Failure/Error: described_class.new(@scaffold_file.path, @sequence_file.path,
Errno::ENOENT:
No such file or directory - /var/folders/yv/c2r06v597n5bdpw_bf8qcmb80000gp/T/gff20120504-25126-d5issp
# ./lib/scaffolder/annotation_locator.rb:58:in `read'
# ./lib/scaffolder/annotation_locator.rb:58:in `records'
# ./lib/scaffolder/annotation_locator.rb:18:in `block in initialize'
# ./lib/scaffolder/annotation_locator.rb:15:in `initialize'
# ./spec/scaffolder/annotation_locator_spec.rb:7:in `new'
# ./spec/scaffolder/annotation_locator_spec.rb:7:in `relocate'
# ./spec/scaffolder/annotation_locator_spec.rb:282:in `block (4 levels) in <top (required)>'
# ./spec/scaffolder/annotation_locator_spec.rb:292:in `block (4 levels) in <top (required)>'
Finished in 2.09 seconds
88 examples, 5 failures
Failed examples:
rspec ./spec/scaffolder/annotation_locator_spec.rb:72 # Scaffolder::AnnotationLocator relocating a single contig start trimmed with a single annotation
rspec ./spec/scaffolder/annotation_locator_spec.rb:142 # Scaffolder::AnnotationLocator relocating a single contig reversed with an insert before an annotation
rspec ./spec/scaffolder/annotation_locator_spec.rb:225 # Scaffolder::AnnotationLocator relocating two contigs where the two annotations are unordered annotations
rspec ./spec/scaffolder/annotation_locator_spec.rb:238 # Scaffolder::AnnotationLocator relocating two contigs where the first of the two contigs is start trimmed
rspec ./spec/scaffolder/annotation_locator_spec.rb:292 # Scaffolder::AnnotationLocator relocating two contigs separated by an unresolved region
rake aborted!
/Users/aaron/.rvm/rubies/ruby-1.9.3-p0/bin/ruby -S rspec spec/scaffolder/annotation_locator_spec.rb spec/scaffolder/gff_record_helper_spec.rb failed
Tasks: TOP => default => spec
(See full trace by running task with --trace)
[aaron@higgins scaffolder-annotation-locator (master)]$ bundle exec rake features
/Users/aaron/.rvm/rubies/ruby-1.9.3-p0/bin/ruby -S bundle exec cucumber
Feature: Parsing contigs with inserts
In order to include inserts in a scaffold
A user can use scaffold-annotation-locator
to update annotation coordinates with respect to contigs with inserts
Scenario: An annotation before an insert in a contig # features/inserts.feature:6
Given a file named "scaf.yml" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
---
- sequence:
source: contig1
inserts:
-
source: insert1
open: 14
close: 15
"""
Given a file named "seq.fna" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
> contig1
AAAAAGGGGGCCCCCTTTTT
> insert1
TTTT
"""
Given a file named "anno.gff" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
##gff-version 3
contig1 . CDS 4 13 . + 1 ID=gene1
"""
When I relocate the annotations using "scaf.yml", "seq.fna" and "anno.gff" # features/step_definitions/scaffolder-annotation-locator_steps.rb:1
Then the result should be: # features/step_definitions/scaffolder-annotation-locator_steps.rb:11
"""
##gff-version 3
scaffold . CDS 4 13 . + 1 ID=gene1
"""
Scenario: An annotation after an insert in a contig # features/inserts.feature:37
Given a file named "scaf.yml" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
---
- sequence:
source: contig1
inserts:
-
source: insert1
open: 1
close: 3
"""
Given a file named "seq.fna" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
> contig1
AAAAAGGGGGCCCCCTTTTT
> insert1
TTTT
"""
Given a file named "anno.gff" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
##gff-version 3
contig1 . CDS 4 13 . + 1 ID=gene1
"""
When I relocate the annotations using "scaf.yml", "seq.fna" and "anno.gff" # features/step_definitions/scaffolder-annotation-locator_steps.rb:1
Then the result should be: # features/step_definitions/scaffolder-annotation-locator_steps.rb:11
"""
##gff-version 3
scaffold . CDS 5 14 . + 1 ID=gene1
"""
Scenario: An annotation before an insert in a reversed contig # features/inserts.feature:68
Given a file named "scaf.yml" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
---
- sequence:
source: contig1
reverse: true
inserts:
-
source: insert1
open: 1
close: 3
"""
Given a file named "seq.fna" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
> contig1
AAAAAGGGGGCCCCCTTTTT
> insert1
TTTT
"""
Given a file named "anno.gff" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
##gff-version 3
contig1 . CDS 4 13 . + 1 ID=gene1
"""
When I relocate the annotations using "scaf.yml", "seq.fna" and "anno.gff" # features/step_definitions/scaffolder-annotation-locator_steps.rb:1
Then the result should be: # features/step_definitions/scaffolder-annotation-locator_steps.rb:11
"""
##gff-version 3
scaffold . CDS 8 17 . - 1 ID=gene1
"""
Scenario: An annotation overlapping with an insert location # features/inserts.feature:100
Given a file named "scaf.yml" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
---
- sequence:
source: contig1
inserts:
-
source: insert1
open: 1
close: 4
"""
Given a file named "seq.fna" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
> contig1
AAAAAGGGGGCCCCCTTTTT
> insert1
TTTT
"""
Given a file named "anno.gff" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
##gff-version 3
contig1 . CDS 4 13 . + 1 ID=gene1
"""
When I relocate the annotations using "scaf.yml", "seq.fna" and "anno.gff" # features/step_definitions/scaffolder-annotation-locator_steps.rb:1
Then the result should be: # features/step_definitions/scaffolder-annotation-locator_steps.rb:11
"""
##gff-version 3
"""
Feature: Locating annotations on single contig scaffold
In order to build a genome from multiple contigs
A user can use scaffold-annotation-locator
to update annotation coordinates with respect from multiple contigs
Scenario: Three annotations on three contigs # features/multiple-contigs.feature:6
Given a file named "scaf.yml" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
---
- sequence:
source: contig1
- sequence:
source: contig2
- sequence:
source: contig3
"""
Given a file named "seq.fna" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
> contig1
AAAAAGGGGGCCCCCTTTTT
> contig2
AAAAAGGGGGCCCCCTTTTT
> contig3
AAAAAGGGGGCCCCCTTTTT
"""
Given a file named "anno.gff" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
##gff-version 3
contig1 . CDS 1 10 . + 1 ID=gene1
contig2 . CDS 1 6 . + 1 ID=gene2
contig3 . CDS 1 6 . + 1 ID=gene2
"""
When I relocate the annotations using "scaf.yml", "seq.fna" and "anno.gff" # features/step_definitions/scaffolder-annotation-locator_steps.rb:1
Then the result should be: # features/step_definitions/scaffolder-annotation-locator_steps.rb:11
"""
##gff-version 3
scaffold . CDS 1 10 . + 1 ID=gene1
scaffold . CDS 21 26 . + 1 ID=gene2
scaffold . CDS 41 46 . + 1 ID=gene2
"""
Scenario: Unordered Annotations on multiple contigs # features/multiple-contigs.feature:42
Given a file named "scaf.yml" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
---
- sequence:
source: contig1
- sequence:
source: contig2
"""
Given a file named "seq.fna" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
> contig1
AAAAAGGGGGCCCCCTTTTT
> contig2
AAAAAGGGGGCCCCCTTTTT
"""
Given a file named "anno.gff" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
##gff-version 3
contig2 . CDS 1 6 . + 1 ID=gene2
contig1 . CDS 1 10 . + 1 ID=gene1
"""
When I relocate the annotations using "scaf.yml", "seq.fna" and "anno.gff" # features/step_definitions/scaffolder-annotation-locator_steps.rb:1
Then the result should be: # features/step_definitions/scaffolder-annotation-locator_steps.rb:11
"""
##gff-version 3
scaffold . CDS 1 10 . + 1 ID=gene1
scaffold . CDS 21 26 . + 1 ID=gene2
"""
Scenario: Annotations on trimmed contigs # features/multiple-contigs.feature:72
Given a file named "scaf.yml" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
---
- sequence:
source: contig1
stop: 17
- sequence:
source: contig2
start: 4
stop: 9
- sequence:
source: contig3
"""
Given a file named "seq.fna" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
> contig1
AAAAAGGGGGCCCCCTTTTT
> contig2
AAAAAGGGGGCCCCCTTTTT
> contig3
AAAAAGGGGGCCCCCTTTTT
"""
Given a file named "anno.gff" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
##gff-version 3
contig1 . CDS 1 10 . + 1 ID=gene1
contig2 . CDS 4 6 . + 1 ID=gene2
contig3 . CDS 1 6 . + 1 ID=gene3
"""
When I relocate the annotations using "scaf.yml", "seq.fna" and "anno.gff" # features/step_definitions/scaffolder-annotation-locator_steps.rb:1
Then the result should be: # features/step_definitions/scaffolder-annotation-locator_steps.rb:11
"""
##gff-version 3
scaffold . CDS 1 10 . + 1 ID=gene1
scaffold . CDS 18 20 . + 1 ID=gene2
scaffold . CDS 24 29 . + 1 ID=gene3
"""
Scenario: Annotations on reversed and trimmed contigs # features/multiple-contigs.feature:111
Given a file named "scaf.yml" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
---
- sequence:
source: contig1
stop: 17
- sequence:
source: contig2
start: 4
stop: 9
reverse: true
- sequence:
source: contig3
reverse: true
"""
Given a file named "seq.fna" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
> contig1
AAAAAGGGGGCCCCCTTTTT
> contig2
AAAAAGGGGGCCCCCTTTTT
> contig3
AAAAAGGGGGCCCCCTTTTT
"""
Given a file named "anno.gff" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
##gff-version 3
contig1 . CDS 1 10 . + 1 ID=gene1
contig2 . CDS 4 6 . + 1 ID=gene2
contig3 . CDS 1 6 . + 1 ID=gene3
"""
When I relocate the annotations using "scaf.yml", "seq.fna" and "anno.gff" # features/step_definitions/scaffolder-annotation-locator_steps.rb:1
Then the result should be: # features/step_definitions/scaffolder-annotation-locator_steps.rb:11
"""
##gff-version 3
scaffold . CDS 1 10 . + 1 ID=gene1
scaffold . CDS 21 23 . - 1 ID=gene2
scaffold . CDS 38 43 . - 1 ID=gene3
"""
Scenario: Annotations on two contigs separated by an unannotated contig # features/multiple-contigs.feature:152
Given a file named "scaf.yml" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
---
- sequence:
source: contig1
- sequence:
source: contig2
- sequence:
source: contig3
"""
Given a file named "seq.fna" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
> contig1
AAAAAGGGGGCCCCCTTTTT
> contig2
AAAAAGGGGGCCCCCTTTTT
> contig3
AAAAAGGGGGCCCCCTTTTT
"""
Given a file named "anno.gff" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
##gff-version 3
contig1 . CDS 1 6 . + 1 ID=gene1
contig3 . CDS 1 6 . + 1 ID=gene2
"""
When I relocate the annotations using "scaf.yml", "seq.fna" and "anno.gff" # features/step_definitions/scaffolder-annotation-locator_steps.rb:1
Then the result should be: # features/step_definitions/scaffolder-annotation-locator_steps.rb:11
"""
##gff-version 3
scaffold . CDS 1 6 . + 1 ID=gene1
scaffold . CDS 41 46 . + 1 ID=gene2
"""
Scenario: Annotations on a single duplicated contig # features/multiple-contigs.feature:186
Given a file named "scaf.yml" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
---
- sequence:
source: contig1
- sequence:
source: contig1
"""
Given a file named "seq.fna" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
> contig1
AAAAAGGGGGCCCCCTTTTT
"""
Given a file named "anno.gff" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
##gff-version 3
contig1 . CDS 1 6 . + 1 ID=gene1
"""
When I relocate the annotations using "scaf.yml", "seq.fna" and "anno.gff" # features/step_definitions/scaffolder-annotation-locator_steps.rb:1
Then the result should be: # features/step_definitions/scaffolder-annotation-locator_steps.rb:11
"""
##gff-version 3
scaffold . CDS 1 6 . + 1 ID=gene1
scaffold . CDS 21 26 . + 1 ID=gene1
"""
Scenario: Annotations on reversed and trimmed contigs with inserts # features/multiple-contigs.feature:213
Given a file named "scaf.yml" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
---
- sequence:
source: contig1
stop: 6
- sequence:
source: contig2
reverse: true
inserts:
-
source: insert1
open: 6
close: 7
- sequence:
source: contig3
start: 3
"""
Given a file named "seq.fna" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
> contig1
AAAAAGGG
> contig2
AAAAAGGGGGC
> contig3
AAAAAGGG
> insert1
TTT
"""
Given a file named "anno.gff" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
##gff-version 3
contig1 . CDS 1 4 . + 1 ID=gene1
contig1 . CDS 5 8 . + 1 ID=gene2
contig2 . CDS 1 4 . + 1 ID=gene3
contig2 . CDS 8 11 . + 1 ID=gene4
contig3 . CDS 1 3 . + 1 ID=gene5
contig3 . CDS 4 8 . + 1 ID=gene6
"""
When I relocate the annotations using "scaf.yml", "seq.fna" and "anno.gff" # features/step_definitions/scaffolder-annotation-locator_steps.rb:1
Then the result should be: # features/step_definitions/scaffolder-annotation-locator_steps.rb:11
"""
##gff-version 3
scaffold . CDS 1 4 . + 1 ID=gene1
scaffold . CDS 15 18 . - 1 ID=gene3
scaffold . CDS 7 10 . - 1 ID=gene4
scaffold . CDS 20 24 . + 1 ID=gene6
"""
Feature: Locating annotations on single contig scaffold
In order to add gff3 annotations to a scaffold
A user can use scaffold-annotation-locator
to return the updated coordinates of scaffold annotations
Scenario: One annotation on a contig # features/single-contig.feature:6
Given a file named "scaf.yml" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
---
- sequence:
source: contig1
"""
Given a file named "seq.fna" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
> contig1
AAAAAGGGGGCCCCCTTTTT
"""
Given a file named "anno.gff" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
##gff-version 3
contig1 . CDS 4 13 . + 1 ID=gene1
"""
When I relocate the annotations using "scaf.yml", "seq.fna" and "anno.gff" # features/step_definitions/scaffolder-annotation-locator_steps.rb:1
Then the result should be: # features/step_definitions/scaffolder-annotation-locator_steps.rb:11
"""
##gff-version 3
scaffold . CDS 4 13 . + 1 ID=gene1
"""
Scenario: One annotation on a reversed contig # features/single-contig.feature:30
Given a file named "scaf.yml" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
---
- sequence:
source: contig1
reverse: true
"""
Given a file named "seq.fna" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
> contig1
AAAAAGGGGGCCCCCTTTTT
"""
Given a file named "anno.gff" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
##gff-version 3
contig1 . CDS 1 6 . + 1 ID=gene1
"""
When I relocate the annotations using "scaf.yml", "seq.fna" and "anno.gff" # features/step_definitions/scaffolder-annotation-locator_steps.rb:1
Then the result should be: # features/step_definitions/scaffolder-annotation-locator_steps.rb:11
"""
##gff-version 3
scaffold . CDS 15 20 . - 1 ID=gene1
"""
Scenario: An annotation in a start trimmed region of the sequence # features/single-contig.feature:55
Given a file named "scaf.yml" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
---
- sequence:
source: contig1
start: 5
"""
Given a file named "seq.fna" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
> contig1
AAAAAGGGGGCCCCCTTTTT
> insert1
TTTT
"""
Given a file named "anno.gff" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
##gff-version 3
contig1 . CDS 4 13 . + 1 ID=gene1
"""
When I relocate the annotations using "scaf.yml", "seq.fna" and "anno.gff" # features/step_definitions/scaffolder-annotation-locator_steps.rb:1
Then the result should be: # features/step_definitions/scaffolder-annotation-locator_steps.rb:11
"""
##gff-version 3
"""
Scenario: An annotation inside a stop trimmed region of the sequence # features/single-contig.feature:81
Given a file named "scaf.yml" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
---
- sequence:
source: contig1
stop: 12
"""
Given a file named "seq.fna" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
> contig1
AAAAAGGGGGCCCCCTTTTT
> insert1
TTTT
"""
Given a file named "anno.gff" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
##gff-version 3
contig1 . CDS 4 13 . + 1 ID=gene1
"""
When I relocate the annotations using "scaf.yml", "seq.fna" and "anno.gff" # features/step_definitions/scaffolder-annotation-locator_steps.rb:1
Then the result should be: # features/step_definitions/scaffolder-annotation-locator_steps.rb:11
"""
##gff-version 3
"""
Scenario: An annotation bordering a stop trimmed region of the sequence # features/single-contig.feature:107
Given a file named "scaf.yml" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
---
- sequence:
source: contig1
stop: 13
"""
Given a file named "seq.fna" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
> contig1
AAAAAGGGGGCCCCCTTTTT
> insert1
TTTT
"""
Given a file named "anno.gff" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
##gff-version 3
contig1 . CDS 4 13 . + 1 ID=gene1
"""
When I relocate the annotations using "scaf.yml", "seq.fna" and "anno.gff" # features/step_definitions/scaffolder-annotation-locator_steps.rb:1
Then the result should be: # features/step_definitions/scaffolder-annotation-locator_steps.rb:11
"""
##gff-version 3
scaffold . CDS 4 13 . + 1 ID=gene1
"""
Scenario: An annotation bordering a start trimmed region of the sequence # features/single-contig.feature:134
Given a file named "scaf.yml" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
---
- sequence:
source: contig1
start: 4
"""
Given a file named "seq.fna" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
> contig1
AAAAAGGGGGCCCCCTTTTT
"""
Given a file named "anno.gff" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
##gff-version 3
contig1 . CDS 4 13 . + 1 ID=gene1
"""
When I relocate the annotations using "scaf.yml", "seq.fna" and "anno.gff" # features/step_definitions/scaffolder-annotation-locator_steps.rb:1
Then the result should be: # features/step_definitions/scaffolder-annotation-locator_steps.rb:11
"""
##gff-version 3
scaffold . CDS 1 10 . + 1 ID=gene1
"""
Feature: Parsing unresolved regions
In order to include unresolved regions in a scaffold
A user can use scaffold-annotation-locator
to update annotation coordinates with respect to unresolved regions
Scenario: Annotations on two contigs separated by an unresolved region # features/unresolved.feature:6
Given a file named "scaf.yml" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
---
- sequence:
source: contig1
- unresolved:
length: 10
- sequence:
source: contig2
"""
Given a file named "seq.fna" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
> contig1
AAAAAGGGGGCCCCCTTTTT
> contig2
AAAAAGGGGGCCCCCTTTTT
"""
Given a file named "anno.gff" with: # aruba-0.4.5/lib/aruba/cucumber.rb:15
"""
##gff-version 3
contig1 . CDS 1 6 . + 1 ID=gene1
contig2 . CDS 1 6 . + 1 ID=gene2
"""
When I relocate the annotations using "scaf.yml", "seq.fna" and "anno.gff" # features/step_definitions/scaffolder-annotation-locator_steps.rb:1
Then the result should be: # features/step_definitions/scaffolder-annotation-locator_steps.rb:11
"""
##gff-version 3
scaffold . CDS 1 6 . + 1 ID=gene1
scaffold . CDS 31 36 . + 1 ID=gene2
"""
18 scenarios (18 passed)
90 steps (90 passed)
0m0.974s
[aaron@higgins scaffolder-annotation-locator (master)]$ ruby -v
ruby 1.9.3p0 (2011-10-30 revision 33570) [x86_64-darwin11.3.0]
[aaron@higgins scaffolder-annotation-locator (master)]$ bundle -v
Bundler version 1.1.3
[aaron@higgins scaffolder-annotation-locator (master)]$ ruby -v
ruby 1.9.3p0 (2011-10-30 revision 33570) [x86_64-darwin11.3.0]
[aaron@higgins scaffolder-annotation-locator (master)]$
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment