This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This allows you to use simple blast search from your chrome location bar. eg. type "bn AGGTTGTATAGTTTGGGGCTCT" | |
Right-click in the chrome location bar, select "Edit Search Engines" | |
Scroll to the bottom | |
- Enter a name, say "blastn" | |
- Enter a keyword, say "bn" | |
- Cut-and-paste the snippit below into the URL | |
https://blast.ncbi.nlm.nih.gov/Blast.cgi?QUERY=%s&db=nucleotide&QUERY_FROM=&QUERY_TO=&QUERYFILE=&GENETIC_CODE=1&JOB_TITLE=&SUBJECTS=&stype=nucleotide&SUBJECTS_FROM=&SUBJECTS_TO=&SUBJECTFILE=&DBTYPE=gc&DATABASE=nr&EQ_MENU=&NUM_ORG=1&EQ_TEXT=&BLAST_PROGRAMS=megaBlast&PHI_PATTERN=&MAX_NUM_SEQ=100&SHORT_QUERY_ADJUST=on&EXPECT=10&WORD_SIZE=28&HSP_RANGE_MAX=0&MATRIX_NAME=PAM30&MATCH_SCORES=1,-2&GAPCOSTS=0 0&COMPOSITION_BASED_STATISTICS=0&FILTER=L&REPEATS=5755&FILTER=m&TEMPLATE_LENGTH=0&TEMPLATE_TYPE=0&PSSM=&I_THRESH=&DI_THRESH=&PSI_PSEUDOCOUNT=&SHOW_OVERVIEW=true&SHOW_LINKOUT=true&GET_SEQUENCE=true&FORMAT_OBJECT=Alignment&FORMAT_TYPE=HTML&ALIGNMENT_VIEW=Pairwise&MASK_CHAR=2&MASK_COLOR=1&DESCRIPTIONS=100&A |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
module FmtLogHandler | |
(fmtLogHandler | |
,logFormatter | |
) where | |
import System.Log.Logger | |
import System.Log | |
import System.Log.Handler | |
import System.IO |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
module Library | |
def self.leaf_paths_of(paths) | |
normalized = paths.map {|s| x=s.squeeze('/'); x+='/'} | |
leafs = normalized.reject { |x| normalized.any? { |a| x != a && a.start_with?(x) } } | |
leafs.map {|x| x.chomp('/') }.uniq | |
end | |
end |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
main() | |
{ | |
float t=1; | |
while(t!=0) { | |
t+=2; | |
} | |
} |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Feature | cdhR-rep1 | cdhR-rep2 | GppX-rep1 | GppX-rep2 | luxS-rep1 | luxS-rep2 | luxS-rep3 | wt-rep1 | wt-rep2 | wt-rep3 | Length | gene | product | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
PG_0001 | 491 | 258 | 198 | 442 | 480 | 737 | 651 | 336 | 633 | 286 | 1422 | dnaA | chromosomal replication initiator protein DnaA | |
PG_0002 | 69 | 54 | 45 | 86 | 84 | 72 | 119 | 92 | 94 | 63 | 573 | hexapeptide transferase family protein | ||
PG_0003 | 107 | 45 | 54 | 62 | 47 | 93 | 76 | 72 | 86 | 26 | 1020 | membrane protein, putative | ||
PG_0004 | 145 | 70 | 100 | 45 | 141 | 170 | 85 | 99 | 232 | 95 | 705 | transcriptional regulator, Sir2 family | ||
PG_0005 | 276 | 172 | 104 | 233 | 189 | 475 | 277 | 181 | 269 | 115 | 1155 | conserved hypothetical protein | ||
PG_0006 | 140 | 92 | 84 | 118 | 85 | 186 | 169 | 89 | 161 | 47 | 1329 | MATE efflux family protein | ||
PG_0007 | 10 | 0 | 5 | 0 | 4 | 2 | 0 | 7 | 1 | 0 | 159 | hypothetical protein | ||
PG_0008 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 939 | ISPg5 transposase Orf2 | ||
PG_0009 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 390 | ISPg5 transposase Orf1 |