Skip to content

Instantly share code, notes, and snippets.

Erik Clarke eclarke

  • Janssen Research & Development
  • Philadelphia, PA
Block or report user

Report or block eclarke

Hide content and notifications from this user.

Learn more about blocking users

Contact Support about this user’s behavior.

Learn more about reporting abuse

Report abuse
View GitHub Profile
@eclarke
eclarke / toggleproxy.sh
Last active Aug 29, 2015
A hackety hack function to toggle SSH/SOCKS proxy on OS X Mavericks
View toggleproxy.sh
function toggleproxy {
# checks to see if SOCKS proxy is enabled
if [[ $(networksetup -getsocksfirewallproxy Wi-Fi | grep '^Enabled') == "Enabled: No" ]]; then
networksetup -setsocksfirewallproxystate Wi-Fi on
echo "SOCKS on!"
# checks to see if there's an existing SSH tunnel and if not, it starts one
if [[ -z $(ps aux | grep '[0-9] ssh -D 8080') ]]; then
echo -ne "Don't see a ssh tunnel on 8080 active, starting one now..."
ssh -D 8080 -f -C -q -N USERNAME@HOSTNAME.EDU # Change this from the defaults!
[[ $? == 0 ]] && echo " success!" || echo " failed :("
View multiplot
# Multiple plot function
#
# ggplot objects can be passed in ..., or to plotlist (as a list of ggplot objects)
# - cols: Number of columns in layout
# - layout: A matrix specifying the layout. If present, 'cols' is ignored.
#
# If the layout is something like matrix(c(1,2,3,3), nrow=2, byrow=TRUE),
# then plot 1 will go in the upper left, 2 will go in the upper right, and
# 3 will go all the way across the bottom.
#
@eclarke
eclarke / notebook.org
Created Oct 22, 2014
Example notebook.org file
View notebook.org

Erik’s Lab Notebook

<2014-09-25 Thu>

Reading this [@Wang:2010fh], in particular Supp. report 4. Has to do with bootstrapping population estimates using the different enzymes used to find

@eclarke
eclarke / rendered-notebook.md
Created Oct 22, 2014
Rendered example notebook.org
View rendered-notebook.md

<2014-09-25 Thu>

Reading this (Wang et al. 2010), in particular Supp. report 4. Has to do with bootstrapping population estimates using the different enzymes used to find integration sites.

<2014-09-26 Fri>

Notes on (Wang et al. 2010) :popest:petersen:intsites:

@eclarke
eclarke / papers2bibtex.scpt
Last active Aug 29, 2015
Applescript to export Papers library as bibtex file
View papers2bibtex.scpt
tell application "Papers"
set outFile to "path_to_notebook_folder/library.bib"
export ((every publication item) as list) to outFile
end tell
@eclarke
eclarke / named.py
Created Feb 12, 2015
Easy dot notation with a dictionary using a context manager
View named.py
# -*- coding: utf-8 -*-
"""
Uses a context manager to provide a dictionary as a 'namespace' of sorts,
allowing you to use dot notation to work with the dictionary. Example:
d = {'a': 5, 'b': 10}
with named(d) as n:
# prints 5
print n.a
# reassignment changes both n and d
View common_otus.fasta
>denovo1793
GGAGTCTGGGCCGTGTCTCAGTCCCAGTGTGGCCGATCACCCTCTCAGGTCGGCTATGTATCGTCGCCTTGGTGAGCCGTTACCCCACCAACTAGCTAATACAACGCAGGTCCATCTGGTAGTGATGCAATTGCACCTTTTAATTGACTATCATGCAATAGTCAATATTATGCGGTATTAGCTATCGTTTCCAATAGTTATCCCCCGCTACCAGGCAGGTTACCTACGCGTTACTCACCCGTTCGCAACTCATCCAGAGAAGCAAGCTCCTCCTTCAGCGTTCTACTTGCATGTATTAGGCACGCCGCCAGCGTTCGTC
>denovo2518
GGAGTTTGGGCCGTGTCTCAGTCCCAATGTGGCCGATCACCCTCTCAGGTCGGCTATGCATCACGGCCTTGGTGAGCCGTTACCTCACCAACTAGCTAATGCACCGCGGGTCCATCCATCAGCAGAAGCTTGCGCCTCTTTTCCTCTTCAAACCATGCGGTTCGAAGACCTATGCGGTTTTAGCATCCGTTTCCGAATGTTATCCCCCTCTGATGGGCAGGTTACCCACGTGTTACTCACCCGTTCGCCACTAGATTGACCAGTGCAAGCACCGGTCGCTCTCGTTCGACTTGCATGTATTAGGCACGCCGCCAGCGTTCGTC
>denovo271
GGAGTCTGGGCCGTGTCTCAGTCCCAGTGTGGCCGATCACCCTCTCAGGTCGGCTATGTATCGTCGCCTTGGTGAGCCGTTACCCCACCAACTAGCTAATACAACGCAGGTCCATCTGGTAGTGATGCAATTGCACCTTTTAAGCAAATGTCATGCAACATTTACTGTTATGCGGTATTAGCTATCGTTTCCAATAGTTATCCCCCGNTACCAGGCAGGTTACCTACGCGTTACTCACCCGTTCGCAACTCGTCCAGAAGAGCAAGCTCTCCCTTCAGCGTTCTACTTGCATGTATTAGGCACGCCGCCAGCGTTCGTC
>denovo3052
GGAGTCTGGTCCG
@eclarke
eclarke / diversity.R
Created Aug 18, 2015
Common diversity metrics
View diversity.R
alpha_diversity <- function(df, group.col, freq.col) {
# Returns a variety of diversity indices, including the Gini-Simpson index,
# the inverse Simpson index, and the Shannon-Weaver index. The SW index is
# calculated using the natural logarithm.
#
# Arguments:
# df: a data frame where the rows are species, with a column containing the
# grouping variable and another column containing the proportional
# abundances of each species
# group: the name of the column defining the grouping variable
@eclarke
eclarke / wikilinks.java
Created Apr 30, 2012
modifying plain wikilinks in wikitext
View wikilinks.java
@eclarke
eclarke / postparams.java
Created May 1, 2012
apache http client inanity
View postparams.java
postParams.add(new BasicNameValuePair("longestOnly","false"));
postParams.add(new BasicNameValuePair("wholeWordOnly","true"));
postParams.add(new BasicNameValuePair("filterNumber", "true"));
postParams.add(new BasicNameValuePair("stopWords","protein,gene,disease,disorder,cell,syndrome,CAN"));
postParams.add(new BasicNameValuePair("withDefaultStopWords","true"));
postParams.add(new BasicNameValuePair("isTopWordsCaseSensitive","false"));
postParams.add(new BasicNameValuePair("mintermSize","3"));
postParams.add(new BasicNameValuePair("scored", "true"));
postParams.add(new BasicNameValuePair("withSynonyms","true"));
postParams.add(new BasicNameValuePair("ontologiesToExpand", ""));
You can’t perform that action at this time.