Reading this [@Wang:2010fh], in particular Supp. report 4. Has to do with bootstrapping population estimates using the different enzymes used to find
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| function toggleproxy { | |
| # checks to see if SOCKS proxy is enabled | |
| if [[ $(networksetup -getsocksfirewallproxy Wi-Fi | grep '^Enabled') == "Enabled: No" ]]; then | |
| networksetup -setsocksfirewallproxystate Wi-Fi on | |
| echo "SOCKS on!" | |
| # checks to see if there's an existing SSH tunnel and if not, it starts one | |
| if [[ -z $(ps aux | grep '[0-9] ssh -D 8080') ]]; then | |
| echo -ne "Don't see a ssh tunnel on 8080 active, starting one now..." | |
| ssh -D 8080 -f -C -q -N USERNAME@HOSTNAME.EDU # Change this from the defaults! | |
| [[ $? == 0 ]] && echo " success!" || echo " failed :(" |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| # Multiple plot function | |
| # | |
| # ggplot objects can be passed in ..., or to plotlist (as a list of ggplot objects) | |
| # - cols: Number of columns in layout | |
| # - layout: A matrix specifying the layout. If present, 'cols' is ignored. | |
| # | |
| # If the layout is something like matrix(c(1,2,3,3), nrow=2, byrow=TRUE), | |
| # then plot 1 will go in the upper left, 2 will go in the upper right, and | |
| # 3 will go all the way across the bottom. | |
| # |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| tell application "Papers" | |
| set outFile to "path_to_notebook_folder/library.bib" | |
| export ((every publication item) as list) to outFile | |
| end tell |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| # -*- coding: utf-8 -*- | |
| """ | |
| Uses a context manager to provide a dictionary as a 'namespace' of sorts, | |
| allowing you to use dot notation to work with the dictionary. Example: | |
| d = {'a': 5, 'b': 10} | |
| with named(d) as n: | |
| # prints 5 | |
| print n.a | |
| # reassignment changes both n and d |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| >denovo1793 | |
| GGAGTCTGGGCCGTGTCTCAGTCCCAGTGTGGCCGATCACCCTCTCAGGTCGGCTATGTATCGTCGCCTTGGTGAGCCGTTACCCCACCAACTAGCTAATACAACGCAGGTCCATCTGGTAGTGATGCAATTGCACCTTTTAATTGACTATCATGCAATAGTCAATATTATGCGGTATTAGCTATCGTTTCCAATAGTTATCCCCCGCTACCAGGCAGGTTACCTACGCGTTACTCACCCGTTCGCAACTCATCCAGAGAAGCAAGCTCCTCCTTCAGCGTTCTACTTGCATGTATTAGGCACGCCGCCAGCGTTCGTC | |
| >denovo2518 | |
| GGAGTTTGGGCCGTGTCTCAGTCCCAATGTGGCCGATCACCCTCTCAGGTCGGCTATGCATCACGGCCTTGGTGAGCCGTTACCTCACCAACTAGCTAATGCACCGCGGGTCCATCCATCAGCAGAAGCTTGCGCCTCTTTTCCTCTTCAAACCATGCGGTTCGAAGACCTATGCGGTTTTAGCATCCGTTTCCGAATGTTATCCCCCTCTGATGGGCAGGTTACCCACGTGTTACTCACCCGTTCGCCACTAGATTGACCAGTGCAAGCACCGGTCGCTCTCGTTCGACTTGCATGTATTAGGCACGCCGCCAGCGTTCGTC | |
| >denovo271 | |
| GGAGTCTGGGCCGTGTCTCAGTCCCAGTGTGGCCGATCACCCTCTCAGGTCGGCTATGTATCGTCGCCTTGGTGAGCCGTTACCCCACCAACTAGCTAATACAACGCAGGTCCATCTGGTAGTGATGCAATTGCACCTTTTAAGCAAATGTCATGCAACATTTACTGTTATGCGGTATTAGCTATCGTTTCCAATAGTTATCCCCCGNTACCAGGCAGGTTACCTACGCGTTACTCACCCGTTCGCAACTCGTCCAGAAGAGCAAGCTCTCCCTTCAGCGTTCTACTTGCATGTATTAGGCACGCCGCCAGCGTTCGTC | |
| >denovo3052 | |
| GGAGTCTGGTCCG |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| alpha_diversity <- function(df, group.col, freq.col) { | |
| # Returns a variety of diversity indices, including the Gini-Simpson index, | |
| # the inverse Simpson index, and the Shannon-Weaver index. The SW index is | |
| # calculated using the natural logarithm. | |
| # | |
| # Arguments: | |
| # df: a data frame where the rows are species, with a column containing the | |
| # grouping variable and another column containing the proportional | |
| # abundances of each species | |
| # group: the name of the column defining the grouping variable |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| public static String fixLinks(String src, Wiki target) { | |
| // add a marker to all the links so we can iterate through them (except the ones that point to wikipedia) | |
| String src2 = src.replaceAll("\\[\\[(?!(wikipedia))", "[[%"); | |
| try { | |
| while (src2.contains("[[%")) { | |
| // extract the link text | |
| int a = src2.indexOf("[[%")+3; // left inner bound |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| postParams.add(new BasicNameValuePair("longestOnly","false")); | |
| postParams.add(new BasicNameValuePair("wholeWordOnly","true")); | |
| postParams.add(new BasicNameValuePair("filterNumber", "true")); | |
| postParams.add(new BasicNameValuePair("stopWords","protein,gene,disease,disorder,cell,syndrome,CAN")); | |
| postParams.add(new BasicNameValuePair("withDefaultStopWords","true")); | |
| postParams.add(new BasicNameValuePair("isTopWordsCaseSensitive","false")); | |
| postParams.add(new BasicNameValuePair("mintermSize","3")); | |
| postParams.add(new BasicNameValuePair("scored", "true")); | |
| postParams.add(new BasicNameValuePair("withSynonyms","true")); | |
| postParams.add(new BasicNameValuePair("ontologiesToExpand", "")); |
OlderNewer