eclarke

function toggleproxy {
  # checks to see if SOCKS proxy is enabled
  if [[ $(networksetup -getsocksfirewallproxy Wi-Fi | grep '^Enabled') == "Enabled: No" ]]; then
    networksetup -setsocksfirewallproxystate Wi-Fi on
    echo "SOCKS on!"
      # checks to see if there's an existing SSH tunnel and if not, it starts one
      if [[ -z $(ps aux | grep '[0-9] ssh -D 8080') ]]; then
  	    echo -ne "Don't see a ssh tunnel on 8080 active, starting one now..."
  	    ssh -D 8080 -f -C -q -N USERNAME@HOSTNAME.EDU   # Change this from the defaults!
  	    [[ $? == 0 ]] && echo " success!" || echo " failed :("

eclarke

# Multiple plot function
#
# ggplot objects can be passed in ..., or to plotlist (as a list of ggplot objects)
# - cols:   Number of columns in layout
# - layout: A matrix specifying the layout. If present, 'cols' is ignored.
#
# If the layout is something like matrix(c(1,2,3,3), nrow=2, byrow=TRUE),
# then plot 1 will go in the upper left, 2 will go in the upper right, and
# 3 will go all the way across the bottom.
#

eclarke

tell application "Papers"
	set outFile to "path_to_notebook_folder/library.bib"
	export ((every publication item) as list) to outFile
end tell

eclarke

Erik’s Lab Notebook

<2014-09-25 Thu>

Reading this [@Wang:2010fh], in particular Supp. report 4. Has to do with bootstrapping population estimates using the different enzymes used to find

eclarke

<2014-09-25 Thu>

Reading this (Wang et al. 2010), in particular Supp. report 4. Has to do with bootstrapping population estimates using the different enzymes used to find integration sites.

<2014-09-26 Fri>

Notes on (Wang et al. 2010) :popest:petersen:intsites:

eclarke

# -*- coding: utf-8 -*-
"""
Uses a context manager to provide a dictionary as a 'namespace' of sorts,
allowing you to use dot notation to work with the dictionary. Example:

d = {'a': 5, 'b': 10}
with named(d) as n:
  # prints 5
  print n.a
  # reassignment changes both n and d

eclarke

>denovo1793
GGAGTCTGGGCCGTGTCTCAGTCCCAGTGTGGCCGATCACCCTCTCAGGTCGGCTATGTATCGTCGCCTTGGTGAGCCGTTACCCCACCAACTAGCTAATACAACGCAGGTCCATCTGGTAGTGATGCAATTGCACCTTTTAATTGACTATCATGCAATAGTCAATATTATGCGGTATTAGCTATCGTTTCCAATAGTTATCCCCCGCTACCAGGCAGGTTACCTACGCGTTACTCACCCGTTCGCAACTCATCCAGAGAAGCAAGCTCCTCCTTCAGCGTTCTACTTGCATGTATTAGGCACGCCGCCAGCGTTCGTC
>denovo2518
GGAGTTTGGGCCGTGTCTCAGTCCCAATGTGGCCGATCACCCTCTCAGGTCGGCTATGCATCACGGCCTTGGTGAGCCGTTACCTCACCAACTAGCTAATGCACCGCGGGTCCATCCATCAGCAGAAGCTTGCGCCTCTTTTCCTCTTCAAACCATGCGGTTCGAAGACCTATGCGGTTTTAGCATCCGTTTCCGAATGTTATCCCCCTCTGATGGGCAGGTTACCCACGTGTTACTCACCCGTTCGCCACTAGATTGACCAGTGCAAGCACCGGTCGCTCTCGTTCGACTTGCATGTATTAGGCACGCCGCCAGCGTTCGTC
>denovo271
GGAGTCTGGGCCGTGTCTCAGTCCCAGTGTGGCCGATCACCCTCTCAGGTCGGCTATGTATCGTCGCCTTGGTGAGCCGTTACCCCACCAACTAGCTAATACAACGCAGGTCCATCTGGTAGTGATGCAATTGCACCTTTTAAGCAAATGTCATGCAACATTTACTGTTATGCGGTATTAGCTATCGTTTCCAATAGTTATCCCCCGNTACCAGGCAGGTTACCTACGCGTTACTCACCCGTTCGCAACTCGTCCAGAAGAGCAAGCTCTCCCTTCAGCGTTCTACTTGCATGTATTAGGCACGCCGCCAGCGTTCGTC
>denovo3052
GGAGTCTGGTCCG

eclarke

alpha_diversity <- function(df, group.col, freq.col) {
  # Returns a variety of diversity indices, including the Gini-Simpson index,
  # the inverse Simpson index, and the Shannon-Weaver index. The SW index is 
  # calculated using the natural logarithm.
  #
  # Arguments:
  # df: a data frame where the rows are species, with a column containing the 
  #   grouping variable and another column containing the proportional 
  #   abundances of each species
  # group: the name of the column defining the grouping variable

eclarke

public static String fixLinks(String src, Wiki target) {
    
    // add a marker to all the links so we can iterate through them (except the ones that point to wikipedia)
    String src2 = src.replaceAll("\\[\\[(?!(wikipedia))", "[[%");
    
    try {
        while (src2.contains("[[%")) {
            
            // extract the link text
            int a = src2.indexOf("[[%")+3;  // left inner bound

eclarke

        postParams.add(new BasicNameValuePair("longestOnly","false"));
        postParams.add(new BasicNameValuePair("wholeWordOnly","true"));
        postParams.add(new BasicNameValuePair("filterNumber", "true"));
        postParams.add(new BasicNameValuePair("stopWords","protein,gene,disease,disorder,cell,syndrome,CAN"));
        postParams.add(new BasicNameValuePair("withDefaultStopWords","true"));
        postParams.add(new BasicNameValuePair("isTopWordsCaseSensitive","false"));
        postParams.add(new BasicNameValuePair("mintermSize","3"));
        postParams.add(new BasicNameValuePair("scored", "true"));
        postParams.add(new BasicNameValuePair("withSynonyms","true")); 
        postParams.add(new BasicNameValuePair("ontologiesToExpand", ""));