Create a gist now

Instantly share code, notes, and snippets.

What would you like to do?
Perl code for the sequence as part of problem 1, weeks 1-2
#!/usr/bin/perl
use warnings;
use strict;
my $seq ="AGACAAGTCGGACGTTTCATCTGAGGGTTCTTCTGCCTCCGCACTTGGTGCACATCAGACAAGGCAATCA
TGGGGGACGCTCAGATGGCAGAGTTTGGAGCAGCAGCTTCTTACCTGCGAAAGTCAGATCGAGAGCGTCT
GGAAGCACAAACCCGTCCCTTTGATATGAAAAAGGAGTGTTTTGTGCCTGATCCAGATGAAGAGTATGTA
AAAGCTTCAATCGTCAGTCGTGAAGGTGACAAAGTCACTGTACAGACTGAGAAAAGAAAGACTGTAACTG
TAAAGGAAGCTGACATTCACCCCCAGAACCCTCCAAAGTTTGATAAAATTGAAGACATGGCAATGTTCAC
CTTCCTTCATGAGCCAGCCGTGCTGTTCAACCTCAAAGAGCGCTATGCAGCATGGATGATCTATACCTAC
TCAGGACTGTTTTGTGTCACTGTCAACCCCTACAAGTGGCTGCCGGTGTACAATCAGGAGGTGGTTGTAG
CCTATAGAGGGAAAAAGAGGAGTGAAGCTCCTCCCCACATCTTTTCCATCTCTGATAACGCCTATCAGTA
CATGCTAACAGACAGGGAAAATCAGTCAATTCTGATCACTGGAGAATCGGGTGCAGGAAAGACTGTGAAC
ACAAAGAGAGTCATTCAGTATTTTGCAAGTATTGCAGCTGGTGGCTCAGCAAAGAAAGAAGGGGCAGAAA
AAAAGGGAACCCTGGAGGATCAAATCATCCAGGCTAACCCTGCTTTGGAAGCTTTTGGCAATGCAAAGAC
CATCAGAAATGACAACTCCTCAAGATTTGGAAAATTCATCCGAATTCATTTTGGTGCCAGTGGAAAGTTG
GCATCAGCTGACATTGAAACATATCTTCTGGAGAAGTCAAGGGTGACTTTTCAGCTTAAAGCTGAAAGGG
ACTATCATATTTTCTACCAAATCCTCTCTCAGCGGAAACCTGAGCTGCTGGAGATGCTGCTCATCACCAA
CAACCCCTATGACTACGCTTACATCTCCCAAGGAGAAACAACCGTAGCTTCAATTAATGATGGTGAAGAA
TTGCTTGCCACTGATGAAGCGTTTGATGTACTAGGCTTCACTCAGGAGGAGAAAAATGGCATCTATAAAT
TGATTGGAGCCATTATGCACTTTGGCAATATGAAGTTCAAACAGAAGCAGAGGGAGGAGCAAGCAGAGGC
TGATGGAACTGAAGATGGAGACAAAGTCGCATATCTGATGGGCCTAAACTCTGCTGACCTTATCAAGGGT
CTGTGCCACCCAAGAGTCAAAGTAGGAAATGAGTGGGTCACCAAAGGACAAAATGTCCAGCAGGTGTACT
ACGCTATTGGTGCACTAGCCAAGTCAGTGTATGAAAAGATGTTCCTTTGGATGGTTGTAAGAATCAATCA
GTCTCTAGACACCAAACAACCACGCCAATACTTCATTGGAGTGCTGGACATTGCTGGCTTTGAGATCTTT
GATTTTAACACCTTTGAGCAACTCTGCATCAACTTTACCAATGAGAAACTGCAACAGTTTTTCAACCACC
ACATGTTTGTGCTGGAACAAGAGGAGTACAAGAAAGAAGGGATTGAATGGGAGTTTATTGACTTTGGCAT
GGACTTGCAGGCCTGCATCGATCTCATTGAGAAACCTATGGGCATCATGTCCATCCTTGAAGAGGAGTGC
ATGTTTCCCAAAGCAAGTGATTCAACCTTTAAAGCAAAGCTTTATGACAACCATCTTGGGAAATCAAATA
ACTTCCAGAAACCAAGAGCAATCAAAGGGAAGCCAGAGTCTCATTTTTCTCTGGTCCACTATGCTGGTAC
AGTTGACTATAATATCAACAACTGGCTGGTGAAGAACAAAGACCCATTAAATGAGACTGTGGTGGGACTC
TTTCAAAAGTCTACAGTCAAACTTCTGTCAATGCTCTTTGCTAACTATGCAGGGACAGAATCAGATAATG
GTAAGGGAGGTAAAGGAGGTGGAAGTAAGAAGAAGGGCTCCTCCTTCCAGACTGTGTCTGCACTCCACAG
GGAAAACTTAAATAAGTTAATGACAAACCTAAGGTCAACTCACCCTCATTTTGTGCGCTGCATCATTCCT
AATGAGACAAAGACTCCTGGTGCAATGGAGAATCCTTTGGTCATGCATCAGCTGCGCTGTAATGGTGTGC
TGGAGGGCATCAGGATTTGCAGGAAGGGCTTCCCCAACAGAATCCTCTATGGGGACTTCAAACAGAGGTA
CCGAATCCTAAATCCTGCAGCCATACCTGAAGGTCAGTTCATAGACAGCAGGAAAGGAGCAGAGAAACTG
TTGGGTTCACTGGATATTGATCACAATCAATATAAATTTGGACACACAAAGGTGTTCTTCAAGGCTGGTT
TACTCGGTCAGCTTGAAGAAATGAGAGATGACAGACTATCTCTAATTATTTCTGGAATTCAGGCAAGATC
CAGAGGACTTCTTGCAAGGGTTGAGTTCCAAAAGATAGTTGAAAGAAGGGATGCCCTACTGGTTATCCAG
TGGAATGTCCGTGCCTTCATGGGGGTGAAAAATTGGCCCTGGATGAAGCTTTTCTTCAAGATAAAACCTC
TTCTCAAGTCAGCAGAAGCAGAGAAAGAGATGGCAAATATGAAAGATGAATTTGCCAAGCTCAAAGAGGC
TTATGCTAAATCCGAAGCGAGAAGGAAAGAGCTAGAAGAAAAAATGGTGTCTCTTCTCCAAGAGAAGAAT
GACCTACAACTTCAAGTTCAAGCGGAGCAAGACAATCTCTGTGATGCAGAGGAACGATGTGACCAGCTCA
TCAAAAACAAGATTCAGCTTGAGGCTAAAGCCAAAGAGCTCACCGAGCGACTTGAGGATGAGGAGGAGAT
GAATGCAGAGCTGACAGCTAAGAAGAGAAAGCTGGAGGACGAATGCTCTGAGCTGAAGAAGGATATTGAT
GATCTGGAGCTCACTCTGGCTAAAGTCGAGAAAGAGAAGCATGCTACTGAGAACAAGGTAAAGAACCTGA
CAGAAGAAATGGCAGCTTTGGACGACATAATCGCAAAGCTGACCAAAGAGAAGAAAGCCTTGCAAGAAGC
TCATCAGCAGACACTGGATGACCTGCAGAGTGAGGAGGACAAAGTCAACACCCTCACCAAGGCAAAAGCA
AAGCTAGAGCAACAAGTAGATGATCTGGAAGGATCTCTTGAGCAAGAAAAGAAGCTCCGCATGGATCTAG
AAAGAGCCAAGAGGAAACTAGAAGGAGACTTGAAATTAACCCAGGAAAGCCTAATGGACCTGGAAAATGA
CAAGCAGCAGTTAGAGGAGCGTCTAAAAAAGAAAGACTTTGAAATCAGTCAGCTCAATGGGAAAATCGAA
GACGAACAAACTATTTGCATTCAGCTGCAGAAAAAACTGAAGGAACTTCAGGCACGTATTGAGGAGCTGG
AGGAAGAGCTTGAGGCAGAAAGAGCTGCTAGAGCCAAAGTGGAGAAACAGAGAGCAGATTTAGCCAGAGA
GCTGGAGGAGATCAGCGAGAGACTGGAGGAGGCTGGAGGAGCTACAGCTGCTCAGATTGAGATGAATAAG
AAACGAGAGGCAGAGTTTCAGAAGCTCCGCAGAGACCTTGAAGAGGCCACTCTGCAGCATGAGGCCACTG
CCGCCACACTCAGGAAAAAACAAGCCGACAGTGTGGCTGAACTTGGAGAGCAGATAGACAATCTGCAGAG
GGTCAAGCAAAAACTGGAGAAGGAGAAAAGTGAACTTAGGCTGGAGTTGGATGATGTAGTCTCAAACATG
GAACATGTTGTAAAGACAAAGGCAAATCTTGAGAAGATGACCAGATCTTTAGAAGACCAAATGAATGAAT
ATAAAACAAAATATGAGGAAGGTCAGCGCTGCATTAATGACTTCACAATGCAGAAATCTAAACTACAATC
TGAAAATGGTGAACTTTCAAGACAGCTGGAGGAAAAGGACTCTCTTGTCTCCCAGCTAACCAGAAGCAAG
ATGTCTTACACTCAGCAAATTGAAGATCTTAAAAGACAACTGGAGGAGGAAACAAAGGCAAAAAGCGCTC
TCGCCCATGCTGTACAGTCAGCCCGTCATGACACAGATCTGCTTAGAGAGCAGTATGAGGAGGAGCAGGA
AGCTAAAGCAGAGCTACAGCGAGGCATGTCCAAAGCTAATTCTGAGGTGGCACAGTGGAGAACCAAGTAC
GAAACTGATGCCATCCAGAGAACTGAAGAACTGGAGGAAGCCAAAAAGAAACTGGCTCAACGCTTACAGG
AAACCGAAGAAGCTGTTGAAGCAGTAAATGCAAAGTGTTCATCTCTTGAAAAGACCAAACACAGACTCCA
AAATGAGATTGAAGATCTTATGGTGGACCTGGAGAGGTCTAATGCGGCTGCTGCAGCCTTAGACAAAAAG
CAAAGAAACTTTGATAAGGTACTGTCTGAGTGGAAGCAGAAGTTTGAAGAGTCGCAAGCCGAGTTAGAGA
GCTCTCAGAAAGAAGCAAGATGTCTTAGCACTGAACTTTTCAAGCTGAAGAACTCCTATGAGGAAGCTTT
AGATCACCTGGAGACCATGAAGAGAGAAAATAAAAATCTCCAAGAGGAGATTTCTGATCTCACCGAGCAA
CTTGGTGAGGGAGGAAAGAGCATCCATGAGCTGGAGAAAATGAGGAAACAGTTGGAGCAAGAAAAAAGTG
AGATTCAATCTGCTCTGGAAGAGGCAGAGGCATCACTGGAGCACGAGGAGGGTAAGATTCTGCGAGCCCA
GCTGGAGTTCAGCCAAATTAAGGCTGATATCGAGCGCAAACTAGCCGAGAAGGATGAAGAGATGGAGCAG
AGCAAACGCAATTTGCAGAGGACCATTGACACTCTGCAAAGCTCCTTGGAGTCAGAAACCAGAAGCAGAA
ATGAGGCCCTCAGAATAAAAAAGAAGATGGAGGGCGACCTGAATGAGATGGAGATCCAGCTTAGTCAGGC
AAACCGACAAGCAGCAGAGGCCCAAAAACAACTTAAGAGTGTGCATGCACATATGAAAGATGCTCAGCTT
CAGCTGGACGACTCCCTGAGAACAAATGAAGATCTTAAGGAGAACACAGCCATTGTAGAGAGACGCAACA
ACCTTCTGCAGGCTGAACTAGAGGAACTCAGAGCAGCTCTTGAGCAAACCGAAAGAGGCCGTAAGCTTGC
TGAGCAGGAGCTTCTGGATACCAGTGAAAGAGTACAGCTGCTGCACTCCCAGAACACAAGCCTGTTAAAT
CAGAAGAAGAAGCTGGAGACGGATATATCCCAGCTTCAGACAGAAGTGGAAGAGGCAGTGCAAGAATGCA
GGAATGCTGAGGAAAAAGCCAAGAAGGCCATCACTGATGCTGCCATGATGGCGGAGGAGCTGAAGAAGGA
GCAGGATACAAGTGCTCACCTGGAGAGGATGAAGAAGAACATGGAGCAGACCATTAAAGACCTGCAGCAT
CGCCTGGATGAAGCAGAACAAATCGCTATGAAGGGAGGCAAGAAACAAGTCCAGAAACTGGAGGCCAGGG
TGAGGGAGCTGGAGAGTGAAGTTGAATCAGAACAGAAGAAGAGCAGTGAGGCGGTGAAAGGAATCCGCAA
ATATGAGAGACGTATAAAAGAACTGACGTATCAGACTGAGGAGGACCGCAAGAATCTGGCTCGTCTGCAA
GATCTGGTTGACAAGCTTCAGCTAAAGGTTAAAGCTTACAAGAGGGCTGCAGAGGAAGCTGAGGAACAAG
CCAACACTAATCTTAGCAAGTTCCGGAAAATCCAGCATGAGCTTGATGAGGCAGAAGAAAGAGCTGACAT
TGCAGAGTCACAAGTCAATAAGCTACGTGCCAAAAGTCGTGATGTCAGTTCTAAGAAGGGACATGATCAA
GAGTAAAGCTCAAGTGGATTTTCTGTGTCTCCGTTATGCTGAATTAGTTTTGTTTTCAGCCTATCTTGCA
TTTCTTCGGTCACTTAGTAGAATAAAGTTGAATTGCATTAA";
$seq =~ s/\s+//g;
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment