I hereby claim:
- I am iimog on github.
- I am iimog (https://keybase.io/iimog) on keybase.
- I have a public key whose fingerprint is A09D B088 B121 3D2E 5594 A81D 1303 8317 284F 6FAC
To claim this, I am signing this object:
Markus J. Ankenbrand iimog
iimog
/ TBro_Individual_CLA
Last active
April 15, 2016 14:32
Individual Contributor License Agreement for TBro (derived from jQuery Foundation ICLA v3.0 https://contribute.jquery.org/CLA/)
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| ###Individual Contributor License Agreement | |
| Thank you for Your interest in TBro. This document clarifies the terms under which You, the person signing this agreement, may make Contributions — which may include without limitation, software, bug fixes, configuration changes, documentation, or any other materials — to any of the projects owned or managed by TBroTeam. | |
| Please read this agreement carefully. If You have questions about these terms, please contact us via [GitHub](https://github.com/TBroTeam). | |
| You accept and agree to the following terms and conditions for Your present and future Contributions submitted to TBro. Except for the license granted herein to Us, You reserve all right, title, and interest in and to Your Contributions. | |
| **Licenses** |
iimog
/ keybase.md
Created
March 15, 2016 16:30
iimog
/ minimal.tax
Created
November 24, 2014 11:00
Example tax that causes a NullPointerException in RDPClassifier crossvalidate
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| 0*Root*-1*0*rootrank | |
| 1*k__Viridiplantae*0*1*kingdom | |
| 2*p__Streptophyta*1*2*phylum | |
| 3*c__asterids*2*3*class | |
| 4*o__Apiales*3*4*order | |
| 5*f__Apiaceae*4*5*family | |
| 6*g__Heracleum*5*6*genus | |
| 7*s__Heracleum sphondylium*6*7*species | |
| 8*c__Liliopsida*2*3*class | |
| 9*o__Poales*8*4*order |
iimog
/ minimal.fa
Created
November 24, 2014 10:59
Example fasta that causes a NullPointerException in RDPClassifier crossvalidate
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| >164458368 Root;k__Viridiplantae;p__Streptophyta;c__asterids;o__Apiales;f__Apiaceae;g__Heracleum;s__Heracleum sphondylium | |
| ACGCATTCACTTGCCCAAAACCACACACTCCTTGAGGAGCTGTGTTGGTTTGAGGGCGGAAATTGGCCTCCCATGCCTTCTCGCATGGTTGGCAAAAAAATGAGTCTCTGGCTATGGACGTCGTGACATTGGTGGTTGTAAAAGACCCTCTTGTCTTGTCGGGCGAATCCGGGTCATCTTAACGAGCTCCAGGACCCTTAGGCGGCACACATTGTGTGCGCTTCGA | |
| >298507601 Root;k__Viridiplantae;p__Streptophyta;c__Liliopsida;o__Poales;f__Poaceae;g__Muhlenbergia;s__Muhlenbergia richardsonis | |
| ACGCCAAAAGACACTCCCCACCCAACCTAGTGGGGACGTGGTATTTGGCTCCTCGTGTCGTTATGCACGGTGGGCAAAAGTTGGGGCTGCCGGCGGTGCCGATCACAGCACAAGGTGGATGACGCAAGTTGTTCTCGGTGCTACGATACAAGCCGTGTACGGCGATGCTATGGCCCTTTGGACCCATTTAATCGAAGCGCGCGTCGCTCGAACCGCGA | |
| >298507603 Root;k__Viridiplantae;p__Streptophyta;c__Liliopsida;o__Poales;f__Poaceae;g__Muhlenbergia;s__Muhlenbergia seatonii | |
| ACGYCAAAAGACACTCCCCRCCTATCTGAGTAGGGATGTGGTATTTGGCCCCTCGTGCCTTTGCGTGCGGTGGGCAAAAGTTGGGGCTGCCGGCGGAGCCGATCACAGCACAAGGTGGATGACGTAAGTTGTTCTCGGTGCTACGATAYGAGCCGCACACGGCAATGCTATGGCCCTTTGGACCCATCAATCGAAGCGCGTG |
NewerOlder