Lisa K. Johnson johnsolk
johnsolk
/ nema_gene_name_id.csv
Created
February 22, 2019 08:17
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| seqid | Name | ||
|---|---|---|---|
| 5 | Transcript_10 | EDO31303 | |
| 9 | Transcript_100 | EDO42116 | |
| 19 | Transcript_101 | EDO42087 | |
| 24 | Transcript_102 | EDO43514 | |
| 39 | Transcript_103 | tr|A7SUP6|A7SUP6_NEMVE Predicted protein OS=Nematostella vectensis OX=45351 GN=v1g217764 PE=4 SV=1 | |
| 58 | Transcript_105 | EDO33432 | |
| 60 | Transcript_107 | tr|A7S0C0|A7S0C0_NEMVE Predicted protein OS=Nematostella vectensis OX=45351 GN=v1g184098 PE=4 SV=1 | |
| 61 | Transcript_109 | EDO49229 | |
| 71 | Transcript_11 | tr|A7RQ19|A7RQ19_NEMVE Predicted protein OS=Nematostella vectensis OX=45351 GN=v1g239897 PE=4 SV=1 |
johnsolk
/ NEBNextAdapt.fa
Created
February 8, 2019 03:40
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| >hairpin_1_fwd | |
| GATCGGAAGAGCACACGTCTGAACTCCAGTC | |
| >hairpin_1_revcomp | |
| GACTGGAGTTCAGACGTGTGCTCTTCCGATC | |
| >hairpin_2_fwd | |
| ACACTCTTTCCCTACACGACGCTCTTCCGATC | |
| >hairpin_2_revcomp | |
| GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT | |
| >Illumina_top | |
| ACACTCTTTCCCTACACGACGCTCTTCCGATC |
johnsolk
/ overLapper_original.R
Created
February 7, 2019 19:58
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| ########################################## | |
| ## Intersect and Venn Diagram Functions ## | |
| ########################################## | |
| ## Author: Thomas Girke | |
| ## Last update: August 15, 2009 | |
| ## Utilities: | |
| ## (1) Venn Intersects | |
| ## Computation of Venn intersects among 2-20 or more sample sets using the typical | |
| ## 'only in' intersect logic of Venn comparisons, such as: objects present only in | |
| ## set A, objects present only in the intersect of A & B, etc. Due to this restrictive |
johnsolk
/ plotPCAWithSampleNames.R
Created
February 7, 2019 19:47
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| # custom script by Igor Dolgolev at NYUMC | |
| plotPCAWithSampleNames = function(x, intgroup="condition", ntop=500) | |
| { | |
| library("genefilter") | |
| library("lattice") | |
| rv = rowVars(assay(x)) | |
| select = order(rv, decreasing=TRUE)[seq_len(min(ntop, length(rv)))] |
johnsolk
/ dammit_gff3_to_trinity_names.py
Last active
December 12, 2018 17:29
— forked from bluegenes/dammit_gff3_to_trinity_names.py
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| ################################################################### | |
| """Function: Take in a dammit gff3, dammit fasta, dammit namemap. | |
| Output gff3 and fasta with trinity names. | |
| by Dr. Tessa Pierce | |
| """ | |
| ################################################################### | |
| import sys | |
| import os | |
| import argparse |
johnsolk
/ top_20_barcodes.sh
Created
August 31, 2018 17:01
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| #outputs top 20 barcodes in file, if there are any | |
| zcat lane1_sample_L001_R1_001.fastq.gz | head -400000 | grep '^@HWI' | cut -d : -f 10 | sort | uniq -c | sort -nr | head -20 |
johnsolk
/ cluster_contigs.ipynb
Created
August 23, 2018 17:57
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
johnsolk
/ A_xenica_PromethION_minreadlength10percent.ipynb
Created
August 15, 2018 20:53
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| >DNA_CS | |
| GCCATCAGATTGTGTTTGTTAGTCGCTTTTTTTTTTTGGAATTTTTTTTTTGGAATTTTTTTTTTGCGCTAACAACCTCCTGCCGTTTTGCCCGTGCATATCGGTCACGAACAAATCTGATTACTAAACACAGTAGCCTGGATTTGTTCTATCAGTAATCGACCTTATTCCTAATTAAATAGAGCAAATCCCCTTATTGGGGGTAAGACATGAAGATGCCAGAAAAACATGACCTGTTGGCCGCCATTCTCGCGGCAAAGGAACAAGGCATCGGGGCAATCCTTGCGTTTGCAATGGCGTACCTTCGCGGCAGATATAATGGCGGTGCGTTTACAAAAACAGTAATCGACGCAACGATGTGCGCCATTATCGCCTAGTTCATTCGTGACCTTCTCGACTTCGCCGGACTAAGTAGCAATCTCGCTTATATAACGAGCGTGTTTATCGGCTACATCGGTACTGACTCGATTGGTTCGCTTATCAAACGCTTCGCTGCTAAAAAAGCCGGAGTAGAAGATGGTAGAAATCAATAATCAACGTAAGGCGTTCCTCGATATGCTGGCGTGGTCGGAGGGAACTGATAACGGACGTCAGAAAACCAGAAATCATGGTTATGACGTCATTGTAGGCGGAGAGCTATTTACTGATTACTCCGATCACCCTCGCAAACTTGTCACGCTAAACCCAAAACTCAAATCAACAGGCGCCGGACGCTACCAGCTTCTTTCCCGTTGGTGGGATGCCTACCGCAAGCAGCTTGGCCTGAAAGACTTCTCTCCGAAAAGTCAGGACGCTGTGGCATTGCAGCAGATTAAGGAGCGTGGCGCTTTACCTATGATTGATCGTGGTGATATCCGTCAGGCAATCGACCGTTGCAGCAATATCTGGGCTTCACTGCCGGGCGCTGGTTATGGTCAGTTCGAGCATAAGGCTGACAGCCTGATTGCAAAATTCAAAGAAGCGGGCGGAACGGTCAGAGAGATTGATGTATGAGCAGAGTCACCGCGATTATCTCC |
johnsolk
/ doi2bib.ipynb
Created
August 14, 2018 18:13
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
NewerOlder