Skip to content

Instantly share code, notes, and snippets.

Ngoc Dao ngocdaothanh

Block or report user

Report or block ngocdaothanh

Hide content and notifications from this user.

Learn more about blocking users

Contact Support about this user’s behavior.

Learn more about reporting abuse

Report abuse
View GitHub Profile
View catalina.out
SUBMITTING job 2014y-3m-8d-9h-40m-44s-236r from 1.72.4.228 (1.72.4.228)
SARTING job 2014y-3m-8d-9h-40m-44s-236r at Sat Mar 08 09:40:44 EST 2014
Primer3 returned no oligos for sequence ACCAATGGTGGCGCGATGTAACACGAGAAAGCACATACCAAGGCCACCACACACCACCTGTCCAAAAAGGCCTTCGATACGGGATAATCCTATTTATTACCTCAGAAGTTTTTTTCTTCGCAGGATTTTTCTGAGCCTTTTACCACTCCA
Primer3 returned no oligos for sequence GCACATACCAAGGCCACCACACACCACCTGTCCAAAAAGGCCTTCGATACGGGATAATCCTATTTATTACCTCAGAAGTTTTTTTCTTCGCAGGATTTTTCTGAGCCTTTTACCACTCCAGCCTAGCCCCTACCCCCCAACTAGGAGGGC
Primer3 returned no oligos for sequence TCCAAAAAGGCCTTCGATACGGGATAATCCTATTTATTACCTCAGAAGTTTTTTTCTTCGCAGGATTTTTCTGAGCCTTTTACCACTCCAGCCTAGCCCCTACCCCCCAACTAGGAGGGCACTGGCCCCCAACAGGCATCAACCAATGGT
Primer3 returned no oligos for sequence TATTTATTACCTCAGAAGTTTTTTTCTTCGCAGGATTTTTCTGAGCCTTTTACCACTCCAGCCTAGCCCCTACCCCCCAACTAGGAGGGCACTGGCCCCCAACAGGCATCAACCAATGGTGGCGCGATGTAACACGAGAAAGCACATACC
Primer3 returned no oligos for sequence CAGGATTTTTCTGAGCCTTTTACCACTCCAGCCTAGCCCCTACCCCCCAACTAGGAGGGCACTGGCCCCCAACAGG
@ngocdaothanh
ngocdaothanh / gist:1133070
Created Aug 8, 2011
Bank of America Merrill Lynch Tokyo
View gist:1133070
Job Title Front Office Developer
Department ELT (Equity Linked Tech)
Team Role Team member
Size of Team 6
Role Type (Perm, Temp, Contract) Perm
Location Tokyo
Reason for Vacancy Replacement
Main Responsibilities:
View gist:1132989
Công ty: AIMNEXT
Lương: 4-6 triệu yen
Công việc: tư vấn giải pháp liên quan đến công nghệ C#, C++, Java
Yêu cầu:
* Làm ở Nhật ít nhất khoảng 1, 2 năm; sau đó có thể làm ở chi nhánh VN
* Độ tuổi: trên dưới 30
* Kinh nghiệm: C#, C++, Java 2, 3 năm trở lên, có kinh nghiệm business hoặc tư vấn càng tốt
* Tiếng Nhật: 1 kyu trở lên
@ngocdaothanh
ngocdaothanh / gist:3293596
Created Aug 8, 2012
Static file serving benchmark: Nginx 1.2.3 VS Xitrum 1.9.2
View gist:3293596
Condition
=========
Machine spec
------------
Machine 1 and Machine 2: same spec
Red Hat Enterprise Linux 6.3 64 bit
EC2 High-Memory Double Extra Large
View gist:3358184
<?xml version="1.0"?>
<!DOCTYPE tsung SYSTEM "/home/ngocdaothanh/opt/tsung-ws-plugin/share/tsung/tsung-1.0.dtd">
<tsung loglevel="notice" version="1.0">
<clients>
<!-- Can't be IP -->
<client host="localhost" cpu="8"/>
<client host="t2" cpu="8"/>
<!--
<client host="t3" cpu="8"/>
<client host="t4" cpu="8"/>
@ngocdaothanh
ngocdaothanh / gist:3615618
Created Sep 4, 2012
FuckingBirds crash after video preview
View gist:3615618
09-04 01:31:34.960: D/MediaPlayer(2268): switchStereoView IN, Stereo Type = -2
09-04 01:31:34.960: D/MediaPlayer(2268): switchStereoView, Stereo Type = 0
09-04 01:31:34.992: E/VideoView(2268): VideoPlaybackBroadcastReceiver intent is NULL!
09-04 01:31:35.000: D/skia(1462): Loading ARM decoder...
09-04 01:31:35.046: W/(157): [SHDISP_EPP]shdisp_epp_api_overlay_set_output start
09-04 01:31:35.203: E/AudioHardwareALSA(157): RE-OPEN AFTER STANDBY:: took 196 msecs
09-04 01:31:35.203: W/AudioFlinger(157): write blocked for 197 msecs, 3 delayed writes, thread 0x7fff0
09-04 01:31:35.328: W/IInputConnectionWrapper(508): showStatusIcon on inactive InputConnection
09-04 01:31:36.796: I/ActivityManager(273): Starting: Intent { cmp=com.iamme.fuckingbirds/.MainActivity } from pid 2268
09-04 01:31:36.976: I/WindowManager(273): Setting rotation to 0, animFlags=1
@ngocdaothanh
ngocdaothanh / gist:3615398
Created Sep 4, 2012
HanoiTours1 crash on Android 2.3.5
View gist:3615398
09-04 00:51:16.320: W/dalvikvm(3421): threadid=8: thread exiting with uncaught exception (group=0x4002d560)
09-04 00:51:16.328: E/AndroidRuntime(3421): FATAL EXCEPTION: AsyncTask #1
09-04 00:51:16.328: E/AndroidRuntime(3421): java.lang.RuntimeException: An error occured while executing doInBackground()
09-04 00:51:16.328: E/AndroidRuntime(3421): at android.os.AsyncTask$3.done(AsyncTask.java:200)
09-04 00:51:16.328: E/AndroidRuntime(3421): at java.util.concurrent.FutureTask$Sync.innerSetException(FutureTask.java:274)
09-04 00:51:16.328: E/AndroidRuntime(3421): at java.util.concurrent.FutureTask.setException(FutureTask.java:125)
09-04 00:51:16.328: E/AndroidRuntime(3421): at java.util.concurrent.FutureTask$Sync.innerRun(FutureTask.java:308)
09-04 00:51:16.328: E/AndroidRuntime(3421): at java.util.concurrent.FutureTask.run(FutureTask.java:138)
09-04 00:51:16.328: E/AndroidRuntime(3421): at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1088)
09-04 00:51:16.328: E/AndroidRuntime(3
@ngocdaothanh
ngocdaothanh / gist:3617649
Created Sep 4, 2012
SmartWallet crash on launch
View gist:3617649
09-04 06:33:57.968: I/ActivityManager(273): Starting: Intent { act=android.intent.action.MAIN cat=[android.intent.category.LAUNCHER] flg=0x10200000 cmp=vinova.vss.moneymanagement.view/.MoneyManagementActivity } from pid 508
09-04 06:33:57.976: E/ResourceType(273): Style contains key with bad entry: 0x01010361
09-04 06:33:57.976: W/WindowManager(273): HistoryRecord{4098eaf0 vinova.vss.moneymanagement.view/.MoneyManagementActivity} failed creating starting window
09-04 06:33:57.976: W/WindowManager(273): java.lang.RuntimeException: Binary XML file line #25: You must supply a layout_height attribute.
09-04 06:33:57.976: W/WindowManager(273): at android.content.res.TypedArray.getLayoutDimension(TypedArray.java:491)
09-04 06:33:57.976: W/WindowManager(273): at android.view.ViewGroup$LayoutParams.setBaseAttributes(ViewGroup.java:3599)
09-04 06:33:57.976: W/WindowManager(273): at android.view.ViewGroup$MarginLayoutParams.<init>(ViewGroup.java:3678)
09-04 06:33:57.976: W/WindowManager(273): at android.widget.Line
@ngocdaothanh
ngocdaothanh / gist:4255689
Created Dec 11, 2012
[erlang-questions] Logging interprocess communication
View gist:4255689
This is *exactly* what the trace BIFs are for
erlang:trace(PidSpec, Bool, TraceFlags) does what you want.
Here is an example:
-module(tracer).
-export([start/0, loop/0, watch/1]).
start() ->
@ngocdaothanh
ngocdaothanh / gist:4544582
Created Jan 16, 2013
Chromium/src/out/Release directory
View gist:4544582
This file has been truncated, but you can view the full file.
.
├── AHEM____.TTF
├── android_fallback_fonts.xml
├── android_main_fonts.xml
├── android_webview
│   ├── AndroidManifest.xml
│   ├── AndroidManifest.xml.d
│   ├── AndroidWebView.ap_
│   ├── AndroidWebView.ap_.d
You can’t perform that action at this time.