Skip to content

Instantly share code, notes, and snippets.


Roderic Page rdmpage

View GitHub Profile
rdmpage / zotero-wikidata-lookup.js
Last active Jul 9, 2020 — forked from zuphilip/zotero-wikidata-lookup.js
Zotero Script for Wikidata Lookup
View zotero-wikidata-lookup.js
// Zotero script look up selected items in Wikidata and
// check whether the DOI can be found there. If results
// are found then the QIDs are saved in the corresponding
// items in the extra field. Some warnings are given for the
// other cases; thus watch the Zotero error console as well
// during execution of the script. [CC0]
var items = Zotero.getActiveZoteroPane().getSelectedItems();
var map = [];
rdmpage /
Last active Oct 3, 2018
OpenBioDiv query to get specimens from MNRJ

OpenBioDiv query to get specimens from MNRJ

Query by Viktor Senderov:

"In order to illustrate the capabilities of OpenBiodiv and draw attention to the impact of the tragically lost collection of the Museu Nacional de Rio de Janeiro (MNRJ), I can ask our system to give me the number of times a specimen from that collection was used in a taxonomic article, and in which ones."

See query at

rdmpage / clements2017-2018.html
Last active Sep 19, 2018
Comparison of eBird checklists for 2017 and 2018
View clements2017-2018.html
html, body{
#wrapper {
rdmpage /
Created Nov 10, 2017 — forked from justinbellamy/
Install Autoconf and Automake on OS X El Capitan
# Install autoconf, automake and libtool smoothly on Mac OS X.
# Newer versions of these libraries are available and may work better on OS X
# This script is originally from
export build=~/devtools # or wherever you'd like to build
rdmpage /
Created Apr 18, 2017 — forked from jprante/
JSON-LD in Elasticsearch
curl -XDELETE 'localhost:9200/jsonld'
curl -XPOST 'localhost:9200/jsonld'
curl -XPUT 'localhost:9200/jsonld/doc/1' -d '
"dc": "",
View Multiple identifiers
== Handling multiple identifiers
Many objects of interest will have multiple identifiers, and each identifier may have different, complementary data associated with it.
One approach is to treat each identifier as a node, and link it to node for the corresponding object (essentially the object is treated as a bnode). We therefore refer to an object as "the object identifier by <identifier>". If we have correctly associated multiple identifiers with the same object, then we can link the two objects together.
When we have a link to create to another object, we use MERGE (id)-[]-(object) to ensure that id-object exists, then we link to it. In the example below we have a work with DOI 10.3897/phytokeys.44.7993, which cites PMID 21653447. First we create the work with DOI 10.3897/phytokeys.44.7993.
rdmpage / query.txt
Created May 19, 2016
Querying Wikipedia for links to BioStor
View query.txt
The Mediawiki API can be used to find qhat wikipedia pages link to BioStor, e.g.:
See for details.
Begin trees; [Treefile saved Thu Aug 20 21:42:14 2015]
>Data file = /Users/rpage/Sites/geojson-phylogeny-demo/bold-api/service/tmp/SAUPA642-10/SAUPA642-10.nex
>Neighbor-joining search settings:
> Ties (if encountered) will be broken systematically
> Distance measure = uncorrected ("p")
> (Tree is unrooted)
rdmpage / Cricula.geojson
Last active May 10, 2016
Cricula barcode map
View Cricula.geojson
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
rdmpage / primers.txt
Last active May 17, 2018
COI DNA barcode primer locations
View primers.txt
Reference COI is NC_003128 Buteo buteo COI
TZBRD035-15.COI-5P [648bp] ctgatctttggtgnatgagcaggcatagccggcacagcacttagcctactaatccgcgcagaactaggacagccaggaacactattgggagacgaccaaatctacaatgtaatcgtaacagcccacgctttcgtcataatcttcttcatagtcatacctattatgatcggaggcttcggaaactgactggttccactcataattggcgccccagacatagcattcccccgcataaataatatgagcttctgactcctcccaccttcttttctcctcctactagcctcctctacagtagaagccggggctggcactggatgaactgtttatccacccctagccggtaatcttgcccacgcgggcgcatcagtagacctggctattttttcccttcacttggcaggcgtgtcgtccatcttaggagctattaactttatcaccacaattattaacataaagccccctgcactatcacaatatcaaacacccctcttcgtatgatccgtcctcattactgctatcctcttactactatccctgccagtcctagccgccgggattacaatactcctcaccgatcgcaacctcaacactacattctttgaccctgcaggaggaggagacccaatcctgtatcaacacctattc
TZBRD019-15.COI-5P tcttcggcgcctgagctggtatagtcggcaccgccctcagcttactcatccgtgcagaactcggccaacccggcacactcctaggtgacgaccaaatttataacgtaatcgttaccgcacatgccttcgtaataatcttcttcatagttataccaatcatgatcggaggattcggaaactgacttgttccactcataattggcgctc
You can’t perform that action at this time.