Skip to content

Instantly share code, notes, and snippets.

@rdmpage
rdmpage / plant_genera.tre
Created November 29, 2023 10:58
Newick tree from Dimitrov, D., Xu, X., Su, X. et al. Diversification of flowering plants in space and time. Nat Commun 14, 7609 (2023). https://doi.org/10.1038/s41467-023-43396-8
((((((Sciadopitys[1]:188.308735,((Cephalotaxus[2]:142.304539,((Torreya[3]:89.769358,Amentotaxus[4]:89.769358)[14341]:46.785101,(Austrotaxus[5]:111.848542,(Pseudotaxus[6]:83.600633,Taxus[7]:83.600633)[14343]:28.247909)[14342]:24.705917)[14340]:5.75008)[14339]:12.291716,(((Fokienia[8]:15.209049,Cunninghamia[9]:15.209049)[14346]:61.849953,Xanthocyparis[10]:77.059002)[14345]:27.702685,(Taiwania[11]:98.552378,(Athrotaxis[12]:90.599681,((Sequoia[13]:47.99678,(Metasequoia[14]:43.626921,Sequoiadendron[15]:43.626921)[14351]:4.369859)[14350]:38.033481,((Cryptomeria[16]:45.856476,(Glyptostrobus[17]:25.785835,Taxodium[18]:25.785835)[14354]:20.070641)[14353]:28.4228,((Papuacedrus[19]:34.840632,((Pilgerodendron[20]:18.669556,Libocedrus[21]:18.669556)[14358]:12.248165,(Austrocedrus[22]:30.061951,((Neocallitropsis[23]:5.794331,(Callitris[24]:5.095635,Actinostrobus[25]:5.095635)[14362]:0.698696)[14361]:16.394056,(Widdringtonia[26]:16.065476,(Fitzroya[27]:8.833227,Diselma[28]:8.833227)[14364]:7.232249)[14363]:6.122911)[14360]:
@rdmpage
rdmpage / legume.tre
Created August 3, 2023 15:13
Newick tree for legumes
('Cercis_canadensis':66.745756598131,((('Medicago_truncatula':37.847072955593,'Glycine_max':37.847072955593):6.0857450219624,('Arachis_ipaensis':34.409341181462,'Nissolia_schottii':34.409341181462):9.5234767960946):22.063391261664,(('Arcoa_gonavensis':51.905808169212,('Tetrapterocarpon_geayi':35.916971163638,('Acrocarpus_fraxinifolius':23.591060643269,'Ceratonia_siliqua':23.591060643269):12.325910520364):15.988837005574):8.5519236454225,(('Umtiza_listeriana':35.729113542994,('Gymnocladus_dioica':20.886946672116,'Gleditsia_chinensis':20.886946672116):14.842166870878):23.144256779574,(((('Batesia_floribunda':39.988047737806,('Recordoxylon_speciosum':23.558014064512,'Melanoxylon_brauna':23.558014064512):16.430034673294):2.6012244899893,('Chamaecrista_adiantifolia':30.217103715139,('Chamaecrista_viscosa':27.090495896652,('Chamaecrista_ramosa':12.853561727372,'Chamaecrista_lineata':12.853561727372):14.23693416928):3.1266078184925)'Chamaecrista':12.372168512653):4.6805972617711,('Cassia_cowanii':37.71443824944,(('S
@rdmpage
rdmpage / clements2017-2018.html
Last active March 9, 2022 17:54
Comparison of eBird checklists for 2017 and 2018
This file has been truncated, but you can view the full file.
<!DOCTYPE html>
<html>
<head>
<style>
html, body{
width:100%;
height:100%;
font-size:14px;
}
@rdmpage
rdmpage / zoobank.dot
Created November 28, 2012 10:43
ZooBank data model
digraph {
1758 -> 1930 -> 1998 -> 2004;
/* publications */
"BC94AF66-4059-4CCA-81D7-FEC49B067B77" [shape="box",label="The fishes of the families Amiidae, Chandidae, Duleidae, and Serranidae\nBC94AF66-4059-4CCA-81D7-FEC49B067B77\nhttp://biostor.org/reference/105997"];
"F8ECE6CE-E77F-4768-A563-62E416592874" [shape="box",label="Belonoperca pylei, a new species of seabass...\nF8ECE6CE-E77F-4768-A563-62E416592874\nDOI:10.1007/BF02725185"];
/* 1930 */
@rdmpage
rdmpage / animals.csv
Last active May 28, 2021 11:45
Summary tree example
node parent label weight
1 0 Animalia 0
2 1 Acanthocephala 1330
3 1 Annelida 15676
4 1 Arthropoda 1114267
5 1 Brachiopoda 396
6 1 Bryozoa 20559
7 1 Chaetognatha 132
8 1 Chordata 0
9 1 Cnidaria 14223
@rdmpage
rdmpage / zoobank.xml
Last active March 11, 2021 13:02
ZooBank LSID XML for a taxon name
<?xml version="1.0" encoding="UTF-8"?>
<rdf:RDF
xmlns:dc="http://purl.org/dc/elements/1.1/"
xmlns:owl="http://www.w3.org/2002/07/owl#"
xmlns:tto="http://rs.tdwg.org/ontology/voc/Specimen#"
xmlns:tc="http://rs.tdwg.org/ontology/voc/TaxonConcept#"
xmlns:dcterms="http://purl.org/dc/terms/"
xmlns:tn="http://rs.tdwg.org/ontology/voc/TaxonName#"
xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#"
xmlns:tpub="http://rs.tdwg.org/ontology/voc/PublicationCitation#"
@rdmpage
rdmpage / zotero-wikidata-lookup.js
Last active July 9, 2020 14:27 — forked from zuphilip/zotero-wikidata-lookup.js
Zotero Script for Wikidata Lookup
// Zotero script look up selected items in Wikidata and
// check whether the DOI can be found there. If results
// are found then the QIDs are saved in the corresponding
// items in the extra field. Some warnings are given for the
// other cases; thus watch the Zotero error console as well
// during execution of the script. [CC0]
var items = Zotero.getActiveZoteroPane().getSelectedItems();
var map = [];
@rdmpage
rdmpage / Design document
Created September 24, 2012 09:37
Full text search in Cloudant
{
"_id": "_design/lookup",
"_rev": "2-2763d098bce604230bfc247ca06cba05",
"language": "javascript",
"indexes": {
"all": {
"index": "function(doc) {\n if (doc.title)\n {\n index(\"title\", doc.title, {\"store\": \"yes\"});\n }\n }"
}
}
}
@rdmpage
rdmpage / README.md
Last active October 3, 2018 12:28
OpenBioDiv query to get specimens from MNRJ

OpenBioDiv query to get specimens from MNRJ

Query by Viktor Senderov:

"In order to illustrate the capabilities of OpenBiodiv and draw attention to the impact of the tragically lost collection of the Museu Nacional de Rio de Janeiro (MNRJ), I can ask our system to give me the number of times a specimen from that collection was used in a taxonomic article, and in which ones."

http://big4-project.eu/news/11665_blog-post-openbiodiv-the-semantic-web-comes-to-biodiversity-informatics/

See query at https://goo.gl/4ovg2o

@rdmpage
rdmpage / primers.txt
Last active May 17, 2018 10:10
COI DNA barcode primer locations
Reference COI is NC_003128 Buteo buteo COI
TZBRD035-15.COI-5P [648bp] ctgatctttggtgnatgagcaggcatagccggcacagcacttagcctactaatccgcgcagaactaggacagccaggaacactattgggagacgaccaaatctacaatgtaatcgtaacagcccacgctttcgtcataatcttcttcatagtcatacctattatgatcggaggcttcggaaactgactggttccactcataattggcgccccagacatagcattcccccgcataaataatatgagcttctgactcctcccaccttcttttctcctcctactagcctcctctacagtagaagccggggctggcactggatgaactgtttatccacccctagccggtaatcttgcccacgcgggcgcatcagtagacctggctattttttcccttcacttggcaggcgtgtcgtccatcttaggagctattaactttatcaccacaattattaacataaagccccctgcactatcacaatatcaaacacccctcttcgtatgatccgtcctcattactgctatcctcttactactatccctgccagtcctagccgccgggattacaatactcctcaccgatcgcaacctcaacactacattctttgaccctgcaggaggaggagacccaatcctgtatcaacacctattc
TZBRD019-15.COI-5P tcttcggcgcctgagctggtatagtcggcaccgccctcagcttactcatccgtgcagaactcggccaacccggcacactcctaggtgacgaccaaatttataacgtaatcgttaccgcacatgccttcgtaataatcttcttcatagttataccaatcatgatcggaggattcggaaactgacttgttccactcataattggcgctc