Navigation Menu

Skip to content

Instantly share code, notes, and snippets.

View sacundim's full-sized avatar

sacundim

20 followers · 2 following
View GitHub Profile
@sacundim
sacundim / .dockerignore
Created August 20, 2023 19:13
Generic DBT project Dockerfile
dbt_packages/
logs/
target/
.user.yml
@sacundim
sacundim / expanding_pango_aliases_with_duckdb.sql
Last active August 7, 2023 21:18
Expanding PANGO lineage aliases with DuckDB
WITH alias_key AS (
UNPIVOT (
SELECT COLUMNS('^(A.+|B.+|[C-WY-Z].*)')
FROM 'https://raw.githubusercontent.com/cov-lineages/pango-designation/master/pango_designation/alias_key.json'
)
ON COLUMNS (*)
INTO NAME prefix VALUE expansion
), lineage_notes AS (
SELECT
regexp_matches(line, '^\*') AS withdrawn,
@sacundim
sacundim / titanic_casualties.csv
Last active June 22, 2023 06:04
Titanic casualties
Passengers Category Number onboard Number saved Number lost
Children First Class 6 5 1
Children Second Class 24 24 0
Children Third Class 79 27 52
Women First Class 144 140 4
Women Second Class 93 80 13
Women Third Class 165 76 89
Women Crew 23 20 3
Men First Class 175 57 118
Men Second Class 168 14 154
@sacundim
sacundim / secuencias_covid-19_PR_2022-10-26.fasta
Created October 27, 2022 06:43
Secuencias de SARS-CoV-2 de Puerto Rico depositadas a GenBank el 2022-10-26. Incluye dos BQ.1*.
>2022-09-22 |PR-CDC-2-6543467
ATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTT
ACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTTGTCCGGGTGTGACC
GAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAG
TTTGCCTGTTTTACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGA
GGTCTTATCAGAGGCACGTCAACATCTTAAAGATGGCACTTGTGGCTTAGTAGAAGTTGA
AAAAGGCGTTTTGCCTCAACTTGAACAGCCCTATGTGTTCATCAAACGTTCGGATGCTCG
AACTGCACCTCATGGTCATGTTATGGTTGAGCTGGTAGCAGAACTCGAAGGCATTCAGTA
CGGTCGTAGTGGTGAGACACTTGGTGTCCTTGTCCCTCATGTGGGCGAAATACCAGTGGC
TTACCGCAAGGTTCTTCTTCGTAAGAACGGTAATAAAGGAGCTGGTGGCCATAGGTACGG
@sacundim
sacundim / Shape.hs
Last active March 31, 2022 14:01
OOP Shape example in Haskell, using existentials, GADTs, Typeable and ConstraintKinds to support downcasts.
{-# LANGUAGE GADTs, ConstraintKinds, KindSignatures, DeriveDataTypeable #-}
{-# LANGUAGE TypeOperators, ScopedTypeVariables, FlexibleInstances #-}
module Shape where
import Control.Applicative ((<$>), (<|>))
import Data.Maybe (mapMaybe)
import Data.Typeable
import GHC.Exts (Constraint)
@sacundim
sacundim / apagones-luma.sh
Last active February 14, 2022 22:04
Descargar datos de apagones de Mi LUMA
#!/usr/bin/env bash
#
# Script para descargar los datos del API que usa la página de apagones
# de LUMA Puerto Rico. Filtramos un poco el resultado para producir un
# "array" de JSON y añadirle un campo llamado `consulta` con la fecha y
# hora (en UTC) que corremos el script.
#
# Herramientas requisito:
#
# * `curl` (disponible por defecto en muchos sistemas): https://curl.se/
@sacundim
sacundim / covariants-count.sh
Created December 9, 2021 04:32
jq-based script to count sequences in Covariants.org
#!/usr/bin/env bash
#
# Fetch data from Covariants.org and count how many sequences
URL='https://raw.githubusercontent.com/hodcroftlab/covariants/master/web/data/perCountryData.json'
COUNTRY="${1?"No country given"}"
curl --compressed "${URL}" | jq "[
.regions
| .[]
@sacundim
sacundim / prestamos_ppp_condonados.csv
Created October 25, 2021 16:51
Condonación de préstamos del Small Business Administration Paycheck Protection Program en Puerto Rico. Préstamos de $150k o más condonados hasta el 30 de junio del 2021.
We can make this file beautiful and searchable if this error is corrected: It looks like row 7 should actually have 12 columns, instead of 6. in line 6.
"Préstamo #","Recipiente","Franquicia","Empleos reportados","Fecha préstamo","Principal","Fecha condonación","Cantidad condonada","Dirección","Ciudad","Estado","Código postal"
7953047007,CARIBBEAN RESTAURANTS LLC,Burger King,500,2020-04-08,10000000,2021-06-11,10118888.89,"5 Carr Km 6 Hm 2 Barrio Amelia",GUAYNABO,PR,"00968"
3828657103,SOUTH AMERICAN RESTAURANTS CORP.,Church's Chicken,500,2020-04-12,10000000,2021-06-11,10117500,"35 Diana St, Amelia Industrial Park",GUAYNABO,PR,"00969"
5502967210,CENTRO MEDICO DEL TURABO INC.,,500,2020-04-27,10000000,2021-06-11,10112222.22,"100 AVE. LUIS MUNOZ MARIN",CAGUAS,PR,"00725"
4150097210,"GENESIS SECURITY SERVICES, INC.",,500,2020-04-27,10000000,2021-04-26,10098333.33,"5900 AVE. ISLA VERDE L2 PMB",CAROLINA,PR,"00979"
8283167002,ENCANTO RESTAURANTS INC,Pizza Hut,500,2020-04-08,9727100,2021-06-11,9841123.23,"9615 AVE LOS ROMEROS 200 Montehiedra Office Centre",SAN JUAN,PR,"00926-7037"
9187527106,"INTERNATIONAL RESTAURANT SERVICES, INC.",Chili's Grill & Bar,500,2020-04-15,89
@sacundim
sacundim / puerto_rico_vaccinations_prdoh_by_dose_date.csv
Created October 16, 2021 01:16
Daily summary of Puerto Rico Department of Health vaccination figures. These are by dose administered date. Recent dates may be incomplete
data_date dose_date doses cumulative_doses initial_doses partial_vaxxed final_doses fully_vaxxed
2021-10-14 2020-12-03 2 2 2 2 0 0
2021-10-14 2020-12-04 1 3 1 3 0 0
2021-10-14 2020-12-05 1 4 1 4 0 0
2021-10-14 2020-12-06 1 5 1 5 0 0
2021-10-14 2020-12-07 1 6 1 6 0 0
2021-10-14 2020-12-08 7 13 7 13 0 0
2021-10-14 2020-12-09 1 14 1 14 0 0
2021-10-14 2020-12-10 3 17 3 17 0 0
2021-10-14 2020-12-11 1 18 1 18 0 0
@sacundim
sacundim / extracción.sh
Created August 12, 2021 19:06
Población municipal de Puerto Rico según Censo 2020, en formato sencillo
#!/usr/bin/env bash
#
# Datos de aquí:
#
# * https://www.census.gov/programs-surveys/decennial-census/about/rdo/summary-files.html
#
# Usa la herramienta `xsv` para procesar el archivo:
#
# * https://github.com/BurntSushi/xsv
#