Example article payload

0066-payload.xml

<root>
    <content-list>
        <list-item>
            <language>en</language>
            <name>front</name>
            <model>href="http://localhost:8081/schemas/elife/article/front.rng"</model>
            <content>
                <front xmlns="http://libero.pub" xmlns:elife="http://elifesciences.org"
                       xmlns:mml="http://www.w3.org/1998/Math/MathML" xml:lang="en">

                    <id>00666</id>
                    <doi>10.7554/eLife.00666</doi>
                    <title>The eLife research article</title>
                    <abstract id="abstract" doi="10.7554/eLife.00666.001">
                        <p>This is the abstract. This article will describe the eLife article and the process. An
                            abstract can contain any formatting, such as <i>italics</i>, <b>bold</b>,
                            <sup>superscript</sup>, <sub>subscript</sub> or <sc>small caps</sc>. MathML is also
                            allowed:
                            <mml:math>
                                <mml:mrow>
                                    <mml:munder>
                                        <mml:mo/>
                                        <mml:mi>m</mml:mi>
                                    </mml:munder>
                                    <mml:mrow>
                                        <mml:msub>
                                            <mml:mover accent="true">
                                                <mml:mi>p</mml:mi>
                                                <mml:mo/>
                                            </mml:mover>
                                            <mml:mi>m</mml:mi>
                                        </mml:msub>
                                        <mml:mo>=</mml:mo>
                                        <mml:mn>0</mml:mn>
                                    </mml:mrow>
                                </mml:mrow>
                            </mml:math>
                            .
                        </p>
                        <p>eLife does not structure abstracts into sub headings expect in a clinical trial article,
                            but the abstract can have multiple paragarahs. The sub DOI is always .001 as it is the
                            first asset in any article. I have added an unmatched > bracket as this has been an
                            issue for PubMed deposits in the past.
                        </p>
                        <p>If this was a clinical trial the clinical trial details would be listed at the end of the
                            abstract:
                        </p>
                        <p>Clinical trial Registration: EudraCT2004-000446-20.</p>
                    </abstract>
                    <elife:digest id="digest" doi="10.7554/eLife.00666.002">
                        <p>eLife digest are now optional and not every research article will contain one. These are
                            layman abstracts, designed for non-specialists in this field to be able to understand
                            this article, as well as the general public.
                        </p>
                        <p>Here is paragraph 2 of the digest.</p>
                    </elife:digest>

                </front>


            </content>
        </list-item>
        <list-item>
            <language>en</language>
            <name>body</name>
            <model>href="http://localhost:8081/schemas/elife/article/body.rng"</model>
            <content>
                <body xmlns="http://libero.pub" xmlns:elife="http://elifesciences.org"
                      xmlns:iiif="http://libero.pub/iiif" xmlns:mml="http://www.w3.org/1998/Math/MathML" xml:lang="en">

                    <section id="s1">
                        <title>Introduction (Level 1 heading)</title>
                        <content>
                            <p>This article is a guide to the tagging and display of eLife articles and will
                                encompass all the elements that can possibly be contained in an eLife article. It
                                will also include information from the author guide. For this reason, it is
                                colloquially known as the eLife 'kitchen sink'.
                            </p>
                            <section id="s1-1">
                                <title>The eLife editorial process (level 2 heading)</title>
                                <content>
                                    <p>eLife publishes the most highly influential research across the life sciences
                                        and biomedicine. Before you submit your work, please note that eLife is a
                                        very selective journal that aims to publish work of the highest scientific
                                        standards and importance. Leading academic researchers evaluate new
                                        submissions and approximately two-thirds are returned to the authors without
                                        further peer review. See <a href="#bib12">DeLano, 2002</a> and <a
                                                href="#bib13">Department of Education and Morgan, 2016</a>.
                                        Approximately half of the articles that are selected for peer review go on
                                        to be published (<a href="#bib5">Brettar et al., 2004a</a>). If other
                                        researchers publish similar findings after submission, this will not be a
                                        reason for rejection. The eLife editorial process broadly occurs in three
                                        phases (<a href="#bib48">Turlings and Wäckers, 2004a</a>; <a href="#bib49"
                                        >Turlings and Wäckers, 2004b</a>; <a href="#bib51">Wolski et al.,
                                            2008</a>; <a href="#bib50">Walker, 1994</a>; <a href="#bib44">Tanaka et
                                            al., 2016</a>). If you are interested in submitting your work to eLife,
                                        please review the guidelines relating to initial submissions. If you have
                                        received an encouraging response to your initial submission, please review
                                        the guidelines relating to full submissions. If your full submission has
                                        been peer reviewed and you have been asked to make revisions, please review
                                        our guidelines for revised submissions (<a href="#bib6">Brettar et al.,
                                            2004b</a>).
                                    </p>
                                    <section id="s1-1-1">
                                        <title>Initial submission (level 3 heading)</title>
                                        <content>
                                            <p>eLife publishes research of the very highest (<a href="#bib7"
                                            >Bricogne et al., 2011</a>) standard and significance, so many
                                                manuscripts are returned to the authors without in-depth peer
                                                review. During the initial submission phase, members of eLife’s
                                                senior editorial team rapidly assess new submissions, often in
                                                consultation with members of the Board of Reviewing Editors or with
                                                external guest editors where necessary, to identify the ones that
                                                are appropriate for in-depth peer review (<a href="#bib8">Cardé and
                                                    Millar, 2004</a>; <a href="#bib9">Cartwright, 2016</a>; <a
                                                        href="#bib10">Chmeil, 2008</a>). To simplify the submission
                                                process, authors should submit their full manuscript as a single
                                                PDF. Limited additional information is collected via the submission
                                                screen questions to complete the submission (<a href="#bib6">Brettar
                                                    et al., 2004b</a>).
                                            </p>
                                        </content>
                                    </section>
                                    <section id="s1-1-2">
                                        <title>Full submission (level 3 heading)</title>
                                        <content>
                                            <p>For manuscripts that are invited for in-depth peer review, see <a
                                                    href="#bib11">Coyne and Orr, 1989
                                            </a> and <a href="#bib14">Du et
                                                al., 2014</a>, we request detailed information about the work to
                                                support the peer review process, to ensure that the work meets
                                                appropriate standards for the reporting of new findings, and, if
                                                accepted, to assist in rapid publication and further dissemination
                                                of the work in relevant indexes and repositories. Authors are asked
                                                to agree to publish their work under the terms of the Creative
                                                Commons Attribution license (PDF of the agreement), or the Creative
                                                Commons CC0 public domain dedication (PDF of the agreement) if one
                                                or more authors are US-government employees (<a href="#bib23"
                                                >Hubbard and Thornton, 1993</a>; <a href="#bib19"
                                                >GlaxoSmithKline UK, 2016</a>; <a href="#bib24">Jain et al.,
                                                    2010</a>).
                                            </p>
                                        </content>
                                    </section>
                                    <section id="s1-1-3">
                                        <title>Revised submission (level 3 heading)</title>
                                        <content>
                                            <p>We will require a response to the essential revision requirements
                                                outlined in the decision letter. A response to minor comments is
                                                optional. In the event of acceptance, the substantive revision
                                                requests and the authors’ response will be published, under the
                                                terms of the Creative Commons Attribution license. In preparation
                                                for submission, authors should ensure they have all the materials
                                                and information necessary to expedite the submission and assessment
                                                of their work (<a href="#bib15">Eisen, 2016</a>; <a href="#bib16"
                                                >Ferry et al., 2014</a>; <a href="#bib18">Gavrilov et al.,
                                                    2014</a>; <a href="#bib20">Goodstadt, 2010</a>; <a href="#bib21"
                                                >Hoang et al., 2015</a>).
                                            </p>
                                        </content>
                                    </section>
                                </content>
                            </section>
                            <section id="s1-2">
                                <title>The eLife production process (level 2 heading)</title>
                                <content>
                                    <section id="s1-2-1">
                                        <title>Immediate publication (accepted manuscript) (level 3 heading)</title>
                                        <content>
                                            <p>On acceptance an eLife article can be published in accepted
                                                manuscript form immediately. The mean time from acceptance to
                                                publication at this stage is 1 day. Using SQl, basic metadata is
                                                exported from the submission system to an AWS bucket as CSV files.
                                                The author files are exported to another AWS bucket and an eLife
                                                process generates a package of this information and the author files
                                                to deliver to the online platform, Continuum.
                                            </p>
                                        </content>
                                    </section>
                                    <section id="s1-2-2">
                                        <title>Publication of the full version (version of record) (level 3
                                            heading)
                                        </title>
                                        <content>
                                            <p>The production process includes an author proofing cycle, the output
                                                of which is the final full text version of the article online, as
                                                well as a typeset PDF.
                                            </p>
                                        </content>
                                    </section>
                                    <section id="s1-2-3">
                                        <title>Publication of versions (level 3 heading)</title>
                                        <content>
                                            <p>eLife allows the publication of updates to an article after the full
                                                version has been produced. These are treated as new versions of the
                                                article. All previous versions of the article will continue to exist
                                                online and will be accessible from the latest live version.
                                            </p>
                                            <section id="s1-2-3-1">
                                                <title>level 4 heading</title>
                                                <content>
                                                    <p>eLife allows up to four levels of headings and no more. This
                                                        is a demonstration of a level 4 heading.
                                                    </p>
                                                </content>
                                            </section>
                                        </content>
                                    </section>
                                </content>
                            </section>
                        </content>
                    </section>
                    <section id="s2">
                        <title>Results</title>
                        <content>
                            <p>This section will be used to demostrate the majority of eLife XML tagging and
                                editorial policies. However, the Introduction section was used to demostrate heading
                                levels. See <a href="#s8">Appendix 1</a> and <a href="#s9">2</a>.
                            </p>
                            <section id="s2-1">
                                <title>eLife controlled lists</title>
                                <content>
                                    <p>eLife has no strict requirements for the display of lists. Below we will show
                                        examples of how to present lists. See <a href="#fig2s1">Figure 2—figure
                                            supplement 1
                                        </a> for the representation of the Major Subject Areas,
                                        Research Organisms and author keywords on the eLife HTML page (
                                        <a
                                                href="#bib45">The <i>Shigella</i> Genome Sequencing Consortium,
                                            2015a
                                        </a>
                                        ).
                                    </p>
                                    <section id="s2-1-1">
                                        <title>Article types</title>
                                        <content>
                                            <p>This is an example of a list where the prefix character is a
                                                lowercase roman numeral. eLife Article Types are taken from a
                                                controlled list:
                                            </p>
                                            <list prefix="roman-lower">
                                                <item>
                                                    <p>Research article</p>
                                                </item>
                                                <item>
                                                    <p>Short Report</p>
                                                </item>
                                                <item>
                                                    <p>Tools and Resources</p>
                                                </item>
                                                <item>
                                                    <p>Research Advance</p>
                                                </item>
                                                <item>
                                                    <p>Registered Report</p>
                                                </item>
                                                <item>
                                                    <p>Replication Study</p>
                                                </item>
                                            </list>
                                            <section id="s2-1-1-1">
                                                <title>Article types (XML only, not display) (level 4
                                                    heading)
                                                </title>
                                                <content>
                                                    <p>This is an example of a list where the prefix character is a
                                                        uppercase roman numeral. This is a controlled list from the
                                                        JATS DTD
                                                    </p>
                                                    <list prefix="roman-upper">
                                                        <item>
                                                            <p>article-commentary (used for Insights)</p>
                                                        </item>
                                                        <item>
                                                            <p>correction</p>
                                                        </item>
                                                        <item>
                                                            <p>discussion (used for Feature 1 and Feature 2)</p>
                                                        </item>
                                                        <item>
                                                            <p>editorial</p>
                                                        </item>
                                                        <item>
                                                            <p>research-article (all reseasrch content)</p>
                                                        </item>
                                                    </list>
                                                    <p>Nested lists are allowed and these are very common in
                                                        Registered Peports. Below is an example of a nested list to
                                                        3 levels.
                                                    </p>
                                                    <p>Genus: Plasmodium; following species are known to infect
                                                        humans
                                                    </p>
                                                    <list prefix="roman-upper">
                                                        <item>
                                                            <list prefix="roman-lower">
                                                                <item>
                                                                    <p>
                                                                        <i>P. falciparum</i>
                                                                    </p>
                                                                </item>
                                                                <item>
                                                                    <p>
                                                                        <i>P. vivax</i>
                                                                    </p>
                                                                </item>
                                                                <item>
                                                                    <p>
                                                                        <i>P. ovale</i>
                                                                    </p>
                                                                </item>
                                                                <item>
                                                                    <p>
                                                                        <i>P. malariae</i>
                                                                    </p>
                                                                </item>
                                                                <item>
                                                                    <p>
                                                                        <i>P. knowlesi</i>
                                                                    </p>
                                                                </item>
                                                            </list>
                                                            <p>Genus: Leishmania. There are 3 subgenus of
                                                                Leishmania:
                                                            </p>
                                                        </item>
                                                        <item>
                                                            <list prefix="roman-lower">
                                                                <item>
                                                                    <p>Leishmania</p>
                                                                </item>
                                                                <item>
                                                                    <p>Sauroleishmania</p>
                                                                </item>
                                                                <item>
                                                                    <p>Viannia</p>
                                                                </item>
                                                                <item>
                                                                    <p>Within Viannia subgenus, there are 11
                                                                        species:
                                                                    </p>
                                                                    <list prefix="bullet">
                                                                        <item>
                                                                            <p>
                                                                                <i>L. braziliensis</i>
                                                                            </p>
                                                                        </item>
                                                                        <item>
                                                                            <p>
                                                                                <i>L. colombiensis</i>
                                                                            </p>
                                                                        </item>
                                                                        <item>
                                                                            <p>
                                                                                <i>L. equatorensis</i>
                                                                            </p>
                                                                        </item>
                                                                        <item>
                                                                            <p>
                                                                                <i>L. guyanensis</i>
                                                                            </p>
                                                                        </item>
                                                                        <item>
                                                                            <p>
                                                                                <i>L. lainsoni</i>
                                                                            </p>
                                                                        </item>
                                                                        <item>
                                                                            <p>
                                                                                <i>L. naiffi</i>
                                                                            </p>
                                                                        </item>
                                                                        <item>
                                                                            <p>
                                                                                <i>L. panamensis</i>
                                                                            </p>
                                                                        </item>
                                                                        <item>
                                                                            <p>
                                                                                <i>L. peruviana</i>
                                                                            </p>
                                                                        </item>
                                                                        <item>
                                                                            <p>
                                                                                <i>L. pifanoi</i>
                                                                            </p>
                                                                        </item>
                                                                        <item>
                                                                            <p>
                                                                                <i>L. shawi</i>
                                                                            </p>
                                                                        </item>
                                                                        <item>
                                                                            <p>
                                                                                <i>L. utingensis</i>
                                                                            </p>
                                                                        </item>
                                                                    </list>
                                                                </item>
                                                            </list>
                                                        </item>
                                                    </list>
                                                </content>
                                            </section>
                                        </content>
                                    </section>
                                    <section id="s2-1-2">
                                        <title>Major Subject Areas</title>
                                        <content>
                                            <p>This is an example of a bulleted list. eLife Major subject areas are
                                                taken from a controlled list:
                                            </p>
                                            <list prefix="bullet">
                                                <item>
                                                    <p>Biochemistry</p>
                                                </item>
                                                <item>
                                                    <p>Biophysics and Structural Biology</p>
                                                </item>
                                                <item>
                                                    <p>Cell Biology</p>
                                                </item>
                                                <item>
                                                    <p>Computational and Systems Biology</p>
                                                </item>
                                                <item>
                                                    <p>Developmental Biology and Stem Cells</p>
                                                </item>
                                                <item>
                                                    <p>Ecology</p>
                                                </item>
                                                <item>
                                                    <p>Epidemiology and Global Health</p>
                                                </item>
                                                <item>
                                                    <p>Genes and Chromosomes</p>
                                                </item>
                                                <item>
                                                    <p>Genomics and Evolutionary Biology</p>
                                                </item>
                                                <item>
                                                    <p>Human Biology and Medicine</p>
                                                </item>
                                                <item>
                                                    <p>Immunology</p>
                                                </item>
                                                <item>
                                                    <p>Microbiology and Infectious Disease</p>
                                                </item>
                                                <item>
                                                    <p>Neuroscience</p>
                                                </item>
                                                <item>
                                                    <p>Plant Biology</p>
                                                </item>
                                            </list>
                                        </content>
                                    </section>
                                    <section id="s2-1-3">
                                        <title>Multi-lists</title>
                                        <content>
                                            <list prefix="number">
                                                <item>
                                                    <p>Here is an example of a list with multiple paragraphs and
                                                        equations.
                                                    </p>
                                                    <p>A discrete three-dimensional model space was generated
                                                        (represented as a three-dimensional matrix; <a
                                                                href="#fig2s1">Figure 2&#x2014;figure supplement 1A</a>,
                                                        left), with dimensions corresponding to population &#x00B5;,
                                                        population &#x03C3;, and f value. Any given value in the
                                                        matrix indicates P(f|&#x03BC;,&#x03C3;), that&#x00A0;is, the
                                                        probability of a given frequency given a particular &#x03BC;
                                                        and &#x03C3;. The columns (all f values for a given &#x03BC;
                                                        and &#x03C3; combination; <a href="#fig2s1">Figure
                                                            2&#x2014;figure supplement 1</a>, upper-right) thus
                                                        constitute the forward model (by which stimuli are
                                                        generated), and the planes (all combinations of &#x03BC; and
                                                        &#x03C3; for a given f value; <a href="#fig2s1">Figure
                                                            2&#x2014;figure supplement 1</a>, lower-middle)
                                                        constitute the inverse model (by which hidden parameters can
                                                        be estimated from observed f values).
                                                    </p>
                                                </item>
                                                <item>
                                                    <p>2) For each segment, the model was inverted for its
                                                        particular f value, yielding a two-dimensional probability
                                                        distribution for the hidden parameters (<a href="#fig2s1"
                                                        >Figure 2&#x2014;figure supplement 1</a>, lower-middle).
                                                        Steps 3-6 were then worked through for each stimulus segment
                                                        in order, starting at the beginning of the stimulus.
                                                    </p>
                                                </item>
                                                <item>
                                                    <p>These probability distributions, for each segment subsequent
                                                        to the most recent estimated population change (as defined
                                                        later), were multiplied together, and scaled to a sum of 1.
                                                        The resulting probability distribution (<a href="#fig2s1"
                                                        >Figure 2&#x2014;figure supplement 1</a>, lower-right)
                                                        thus reflects parameter probabilities taking into account
                                                        all relevant f values
                                                    </p>
                                                </item>
                                                <item>
                                                    <p>This combined parameter probability distribution was then
                                                        scalar multiplied with the full model space, in order to
                                                        weight each of the forward model columns (each corresponding
                                                        to a particular parameter combination) by the probability of
                                                        that parameter combination being in effect. The resulting
                                                        weighted model space was then averaged across parameter
                                                        dimensions, to yield a one-dimensional (forward) probability
                                                        distribution, constituting an optimal prediction about the f
                                                        value of the next stimulus segment, provided a population
                                                        change did not occur before then. A probability distribution
                                                        applicable if a population change were to occur was
                                                        calculated the same way, but without weighting the forward
                                                        model columns (so as to encompass every possible parameter
                                                        combination).
                                                    </p>
                                                </item>
                                                <item>
                                                    <p>It was assumed that a population change occurred immediately
                                                        prior to the first stimulus segment. To infer subsequent
                                                        population changes, for each segment the probability of
                                                        observing the present f value was compared for the two
                                                        probability distributions (the distribution assuming a
                                                        population change, and the distribution assuming no change),
                                                        that&#x00A0;is, P(f|c) and P(f|&#x007E;c), respectively,
                                                        with c denoting a population change. The probabilities were
                                                        compared, in conjunction with the known prior probability of
                                                        a population change (1/8), using Bayes&#x2019; rule, as
                                                        stated in Equation 2:
                                                    </p>
                                                    <mathml id="equ1">
                                                        <label>(1)</label>
                                                        <mml:math id="m2">
                                                            <mml:mrow>
                                                                <mml:mi>P</mml:mi>
                                                                <mml:mo>(</mml:mo>
                                                                <mml:mi>c</mml:mi>
                                                                <mml:mo>|</mml:mo>
                                                                <mml:mi>f</mml:mi>
                                                                <mml:mo>)</mml:mo>
                                                                <mml:mo>=</mml:mo>
                                                                <mml:mfrac>
                                                                    <mml:mrow>
                                                                        <mml:mi>P</mml:mi>
                                                                        <mml:mrow>
                                                                            <mml:mo>(</mml:mo>
                                                                            <mml:mrow>
                                                                                <mml:mi>f</mml:mi>
                                                                                <mml:mtext>|</mml:mtext>
                                                                                <mml:mi>c</mml:mi>
                                                                            </mml:mrow>
                                                                            <mml:mo>)</mml:mo>
                                                                        </mml:mrow>
                                                                        <mml:mi>P</mml:mi>
                                                                        <mml:mo>(</mml:mo>
                                                                        <mml:mi>c</mml:mi>
                                                                        <mml:mo>)</mml:mo>
                                                                    </mml:mrow>
                                                                    <mml:mrow>
                                                                        <mml:mi>P</mml:mi>
                                                                        <mml:mo>(</mml:mo>
                                                                        <mml:mi>f</mml:mi>
                                                                        <mml:mo>)</mml:mo>
                                                                    </mml:mrow>
                                                                </mml:mfrac>
                                                            </mml:mrow>
                                                        </mml:math>
                                                    </mathml>
                                                    <p>Here, P(c|f) is the chance that a population change occurred
                                                        at that particular time. Given that P(c) is known to be 1/8,
                                                        and P(f), the total probability of the observed f value, can
                                                        be rewritten P(f|c)P(c)+P(f|&#x007E;c)(1-P(c)), the above
                                                        equation can be rewritten as Equation 3:
                                                    </p>
                                                    <mathml
                                                            id="equ2">
                                                        <label>(2)</label>
                                                        <mml:math id="m3">
                                                            <mml:mrow>
                                                                <mml:mi>P</mml:mi>
                                                                <mml:mrow>
                                                                    <mml:mo>(</mml:mo>
                                                                    <mml:mrow>
                                                                        <mml:mi>c</mml:mi>
                                                                        <mml:mtext>|</mml:mtext>
                                                                        <mml:mi>f</mml:mi>
                                                                    </mml:mrow>
                                                                    <mml:mo>)</mml:mo>
                                                                </mml:mrow>
                                                                <mml:mo>=</mml:mo>
                                                                <mml:mfrac>
                                                                    <mml:mn>1</mml:mn>
                                                                    <mml:mrow>
                                                                        <mml:mn>1</mml:mn>
                                                                        <mml:mo>+</mml:mo>
                                                                        <mml:mfrac>
                                                                            <mml:mrow>
                                                                                <mml:mn>7</mml:mn>
                                                                                <mml:mi>P</mml:mi>
                                                                                <mml:mo>(</mml:mo>
                                                                                <mml:mi>f</mml:mi>
                                                                                <mml:mo>|</mml:mo>
                                                                                <mml:mo>&#x007E;</mml:mo>
                                                                                <mml:mi>c</mml:mi>
                                                                                <mml:mo>)</mml:mo>
                                                                            </mml:mrow>
                                                                            <mml:mrow>
                                                                                <mml:mi>P</mml:mi>
                                                                                <mml:mo>(</mml:mo>
                                                                                <mml:mi>f</mml:mi>
                                                                                <mml:mo>|</mml:mo>
                                                                                <mml:mi>c</mml:mi>
                                                                                <mml:mo>)</mml:mo>
                                                                            </mml:mrow>
                                                                        </mml:mfrac>
                                                                    </mml:mrow>
                                                                </mml:mfrac>
                                                            </mml:mrow>
                                                        </mml:math>
                                                    </mathml>
                                                </item>
                                                <item>
                                                    <p>For each segment, the above calculation of P(c|f) was made
                                                        not only with respect to the immediately preceding segment,
                                                        but also a number of segments preceding that, up to a
                                                        maximum of 4. Therefore, for segment t, it was possible to
                                                        conclude that a population change had occurred immediately
                                                        prior to t, t-1, t-2, t-3, or none of the above. A
                                                        population change was judged to have occurred at the time
                                                        point with the highest value of P(c|f), provided this value
                                                        was greater than 0.5. Using more than 4 lags did not
                                                        appreciably alter the estimates obtained by model inversion.
                                                        Importantly, any retrospective inference of population
                                                        changes did not retrospectively alter any prior predictions
                                                        generated by the model (e.g. at time t, if a population
                                                        change were inferred to have occurred at time t-3 then the
                                                        priors for t-2, t-1 and t were not affected, but only the
                                                        priors for t+1 onwards).
                                                    </p>
                                                </item>
                                                <item>
                                                    <p>Once the above steps were worked through for each stimulus
                                                        segment in order, the optimal prior predictions were used to
                                                        calculate the perceptual inference variables of interest.
                                                        Predictions themselves were summarised by their mean
                                                        (&#x03BC;) and precision (1/variance). Changes to
                                                        predictions (&#x0394;&#x00B5;) were calculated as the
                                                        absolute change (in octaves) in &#x03BC; from one prediction
                                                        to the next. Surprise (S) was calculated as the negative log
                                                        probability of the observed f value given the prior
                                                        prediction, and prediction error (irrespective of prediction
                                                        precision) was calculated as the absolute difference (in
                                                        octaves) between the observed f value and the mean of the
                                                        prior prediction. Mathematically, surprise is directly
                                                        proportional to prediction precision multiplied by
                                                        prediction error. Finally, &#x0394;f was calculated as the
                                                        absolute difference between the current and preceding value
                                                        of f.
                                                    </p>
                                                </item>
                                            </list>
                                        </content>
                                    </section>
                                    <section id="s2-1-4">
                                        <title>Research Organisms</title>
                                        <content>
                                            <p>This is an example of an ordered list, the "system" will default to
                                                numbers. eLife Research organsims are taken from a controlled list
                                                from the submission system:
                                            </p>
                                            <list prefix="number">
                                                <item>
                                                    <p>
                                                        <i>Arabidopsis</i>
                                                    </p>
                                                </item>
                                                <item>
                                                    <p><i>B</i>.
                                                        <i>subtilis</i>
                                                    </p>
                                                </item>
                                                <item>
                                                    <p><i>C</i>.
                                                        <i>elegans</i>
                                                    </p>
                                                </item>
                                                <item>
                                                    <p><i>C</i>.
                                                        <i>intestinalis</i>
                                                    </p>
                                                </item>
                                                <item>
                                                    <p>Chicken</p>
                                                </item>
                                                <item>
                                                    <p><i>D</i>.
                                                        <i>melanogaster</i>
                                                    </p>
                                                </item>
                                                <item>
                                                    <p>
                                                        <i>Dictyostelium</i>
                                                    </p>
                                                </item>
                                                <item>
                                                    <p><i>E</i>.
                                                        <i>coli</i>
                                                    </p>
                                                </item>
                                                <item>
                                                    <p>Frog</p>
                                                </item>
                                                <item>
                                                    <p>Human</p>
                                                </item>
                                                <item>
                                                    <p><i>M</i>.
                                                        <i>mulatta</i>
                                                    </p>
                                                </item>
                                                <item>
                                                    <p>Maize</p>
                                                </item>
                                                <item>
                                                    <p>Mouse</p>
                                                </item>
                                                <item>
                                                    <p><i>M</i>.
                                                        <i>thermophila</i>
                                                    </p>
                                                </item>
                                                <item>
                                                    <p><i>M</i>.
                                                        <i>crassa</i>
                                                    </p>
                                                </item>
                                                <item>
                                                    <p>
                                                        <i>Neurospora</i>
                                                    </p>
                                                </item>
                                                <item>
                                                    <p>None</p>
                                                </item>
                                                <item>
                                                    <p>Other</p>
                                                </item>
                                                <item>
                                                    <p><i>O</i>.
                                                        <i>fasciatus</i>
                                                    </p>
                                                </item>
                                                <item>
                                                    <p><i>P</i>.
                                                        <i>falciparum</i>
                                                    </p>
                                                </item>
                                                <item>
                                                    <p><i>P</i>.
                                                        <i>dumerilii</i>
                                                    </p>
                                                </item>
                                                <item>
                                                    <p>Rat</p>
                                                </item>
                                                <item>
                                                    <p><i>S</i>.
                                                        <i>cerevisiae</i>
                                                    </p>
                                                </item>
                                                <item>
                                                    <p><i>S</i>.
                                                        <i>pombe</i>
                                                    </p>
                                                </item>
                                                <item>
                                                    <p><i>S</i>. <i>enterica</i>serovar Typhi
                                                    </p>
                                                </item>
                                                <item>
                                                    <p><i>S</i>.
                                                        <i>pyogenes</i>
                                                    </p>
                                                </item>
                                                <item>
                                                    <p>Virus</p>
                                                </item>
                                                <item>
                                                    <p>
                                                        <i>Volvox</i>
                                                    </p>
                                                </item>
                                                <item>
                                                    <p>
                                                        <i>Xenopus</i>
                                                    </p>
                                                </item>
                                                <item>
                                                    <p><i>P</i>.
                                                        <i>cynocephalus</i>
                                                    </p>
                                                </item>
                                                <item>
                                                    <p>Zebrafish</p>
                                                </item>
                                            </list>
                                            <p>However, additional research organisms can be added during the
                                                production process so this is not a controlled list once it is
                                                output from the editorial system. The research organism "Other" is
                                                hidden from display on the eLife website.
                                            </p>
                                        </content>
                                    </section>
                                </content>
                            </section>
                            <section id="s2-2">
                                <title>Tables</title>
                                <content>
                                    <p>This section is an example of different tables, there are four in total (<a
                                            href="#table1">Tables 1 to 3
                                    </a> and an unnamed inline table).
                                    </p>
                                    <figure>
                                        <asset>
                                            <label>Table 1.</label>
                                            <table id="table1">
                                                <doi>10.7554/eLife.00666.003</doi>
                                                <title>This is the title.</title>
                                                <caption>
                                                    <p>This is the caption: A table containing interesting formating
                                                        that is large enough to require landscape orientation in the
                                                        PDF.
                                                    </p>
                                                </caption>
                                                <thead>
                                                    <tr>
                                                        <th colspan="3" rowspan="2"> </th>
                                                        <th align="center" colspan="8">GLVs (percent IS
                                                            plant<sup>-1</sup>)
                                                        </th>
                                                        <th align="center" colspan="17">TPS10 products (percent IS
                                                            plant<sup>-1</sup>)
                                                        </th>
                                                        <th align="center" colspan="10">Non-target volatiles
                                                            (percent IS plant<sup>-1</sup>)
                                                        </th>
                                                    </tr>
                                                    <tr>
                                                        <th align="center" colspan="8">(<i>Z</i>)-Hexen-3-ol
                                                        </th>
                                                        <th align="center" colspan="10">TAB</th>
                                                        <th align="center" colspan="7">TBF</th>
                                                        <th align="center" colspan="6">α-Duprezianene</th>
                                                        <th align="center" colspan="4">Germacrene A</th>
                                                    </tr>
                                                </thead>
                                                <tbody>
                                                    <tr>
                                                        <td>
                                                            <b>Genotype</b>
                                                        </td>
                                                        <td>
                                                            <b>Day n</b>
                                                        </td>
                                                        <td>
                                                            <b>Night n</b>
                                                        </td>
                                                        <td colspan="3">
                                                            <b>Day</b>
                                                        </td>
                                                        <td colspan="5">
                                                            <b>Night</b>
                                                        </td>
                                                        <td colspan="4">
                                                            <b>Day</b>
                                                        </td>
                                                        <td colspan="6">
                                                            <b>Night</b>
                                                        </td>
                                                        <td colspan="4">
                                                            <b>Day</b>
                                                        </td>
                                                        <td colspan="3">
                                                            <b>Night</b>
                                                        </td>
                                                        <td colspan="3">
                                                            <b>Day</b>
                                                        </td>
                                                        <td colspan="3">
                                                            <b>Night</b>
                                                        </td>
                                                        <td colspan="3">
                                                            <b>Day</b>
                                                        </td>
                                                        <td>
                                                            <b>Night</b>
                                                        </td>
                                                    </tr>
                                                    <tr>
                                                        <td>
                                                            <b>WT</b>
                                                        </td>
                                                        <td>8</td>
                                                        <td>8</td>
                                                        <td>0.99%</td>
                                                        <td>±</td>
                                                        <td>0.99%</td>
                                                        <td>7.96%</td>
                                                        <td>±</td>
                                                        <td>4.25%</td>
                                                        <td rowspan="2" valign="middle">
                                                            <elife:color color="blue">}</elife:color>
                                                        </td>
                                                        <td rowspan="2" valign="middle">
                                                            <b>
                                                                <elife:color color="blue">a</elife:color>
                                                            </b>
                                                            <sub>
                                                                <b>
                                                                    <elife:color color="blue">lox</elife:color>
                                                                </b>
                                                            </sub>
                                                        </td>
                                                        <td>0.37%</td>
                                                        <td>±</td>
                                                        <td>0.29%</td>
                                                        <td>
                                                            <b>
                                                                <elife:color color="blue">a</elife:color>
                                                            </b>
                                                        </td>
                                                        <td colspan="3">—</td>
                                                        <td> </td>
                                                        <td rowspan="3" valign="middle">
                                                            <elife:color color="blue">}</elife:color>
                                                        </td>
                                                        <td rowspan="2" valign="bottom">
                                                            <b>
                                                                <elife:color color="blue">a</elife:color>
                                                            </b>
                                                            <sub>
                                                                <b>
                                                                    <elife:color color="blue">TPS</elife:color>
                                                                </b>
                                                            </sub>
                                                        </td>
                                                        <td colspan="3">—</td>
                                                        <td>
                                                            <b>
                                                                <elife:color color="blue">a</elife:color>
                                                            </b>
                                                        </td>
                                                        <td colspan="3">—</td>
                                                        <td>
                                                            <elife:color color="purple">2.13%</elife:color>
                                                        </td>
                                                        <td>
                                                            <elife:color color="purple">±</elife:color>
                                                        </td>
                                                        <td>
                                                            <elife:color color="purple">0.85%</elife:color>
                                                        </td>
                                                        <td>
                                                            <elife:color color="purple">0.96%</elife:color>
                                                        </td>
                                                        <td>
                                                            <elife:color color="purple">±</elife:color>
                                                        </td>
                                                        <td>
                                                            <elife:color color="purple">0.42%</elife:color>
                                                        </td>
                                                        <td>
                                                            <elife:color color="purple">1.68%</elife:color>
                                                        </td>
                                                        <td>
                                                            <elife:color color="purple">±</elife:color>
                                                        </td>
                                                        <td>
                                                            <elife:color color="purple">0.98%</elife:color>
                                                        </td>
                                                        <td>—</td>
                                                    </tr>
                                                    <tr>
                                                        <td>
                                                            <b>
                                                                <i>TPS10</i>
                                                            </b>
                                                        </td>
                                                        <td>7</td>
                                                        <td>7</td>
                                                        <td>2.37%</td>
                                                        <td>±</td>
                                                        <td>1.55%</td>
                                                        <td>2.84%</td>
                                                        <td>±</td>
                                                        <td>0.63%</td>
                                                        <td>18.97%</td>
                                                        <td>±</td>
                                                        <td>6.03%</td>
                                                        <td>
                                                            <b>
                                                                <elife:color color="red">b</elife:color>
                                                            </b>
                                                        </td>
                                                        <td>0.94%</td>
                                                        <td>±</td>
                                                        <td>0.53%</td>
                                                        <td rowspan="3" valign="middle">
                                                            <elife:color color="red">}</elife:color>
                                                        </td>
                                                        <td>9.34%</td>
                                                        <td>±</td>
                                                        <td>3.44%</td>
                                                        <td>
                                                            <b>
                                                                <elife:color color="red">b</elife:color>
                                                            </b>
                                                        </td>
                                                        <td>0.20%</td>
                                                        <td>±</td>
                                                        <td>0.20%</td>
                                                        <td>9.47%</td>
                                                        <td>±</td>
                                                        <td>5.26%</td>
                                                        <td>0.94%</td>
                                                        <td>±</td>
                                                        <td>0.26%</td>
                                                        <td>2.78%</td>
                                                        <td>±</td>
                                                        <td>1.52%</td>
                                                        <td>—</td>
                                                    </tr>
                                                    <tr>
                                                        <td>
                                                            <b>
                                                                <i>lox2/3</i>
                                                            </b>
                                                        </td>
                                                        <td>7</td>
                                                        <td>8</td>
                                                        <td>0.13%</td>
                                                        <td>±</td>
                                                        <td>0.13%</td>
                                                        <td>1.06%</td>
                                                        <td>±</td>
                                                        <td>0.64%</td>
                                                        <td rowspan="2" valign="middle">
                                                            <elife:color color="red">}</elife:color>
                                                        </td>
                                                        <td rowspan="2" valign="middle">
                                                            <b>
                                                                <elife:color color="red">b</elife:color>
                                                            </b>
                                                            <sub>
                                                                <b>
                                                                    <elife:color color="red">lox</elife:color>
                                                                </b>
                                                            </sub>
                                                        </td>
                                                        <td colspan="3">—</td>
                                                        <td>
                                                            <b>
                                                                <elife:color color="blue">a</elife:color>
                                                            </b>
                                                        </td>
                                                        <td>0.15%</td>
                                                        <td>±</td>
                                                        <td>0.15%</td>
                                                        <td rowspan="2">
                                                            <b>
                                                                <elife:color color="red">b</elife:color>
                                                            </b>
                                                            <sub>
                                                                <b>
                                                                    <elife:color color="red">TPS</elife:color>
                                                                </b>
                                                            </sub>
                                                        </td>
                                                        <td colspan="3">—</td>
                                                        <td>
                                                            <b>
                                                                <elife:color color="blue">a</elife:color>
                                                            </b>
                                                        </td>
                                                        <td colspan="3">—</td>
                                                        <td>2.75%</td>
                                                        <td>±</td>
                                                        <td>1.12%</td>
                                                        <td>0.60%</td>
                                                        <td>±</td>
                                                        <td>0.19%</td>
                                                        <td>1.68%</td>
                                                        <td>±</td>
                                                        <td>1.49%</td>
                                                        <td>—</td>
                                                    </tr>
                                                    <tr>
                                                        <td>
                                                            <b><i>lox2/3</i>x
                                                                <i>TPS10</i>
                                                            </b>
                                                        </td>
                                                        <td>7</td>
                                                        <td>7</td>
                                                        <td>0.07%</td>
                                                        <td>±</td>
                                                        <td>0.07%</td>
                                                        <td>1.24%</td>
                                                        <td>±</td>
                                                        <td>0.84%</td>
                                                        <td>7.39%</td>
                                                        <td>±</td>
                                                        <td>2.56%</td>
                                                        <td>
                                                            <b>
                                                                <elife:color color="red">b</elife:color>
                                                            </b>
                                                        </td>
                                                        <td>2.08%</td>
                                                        <td>±</td>
                                                        <td>0.84%</td>
                                                        <td> </td>
                                                        <td>4.47%</td>
                                                        <td>±</td>
                                                        <td>1.70%</td>
                                                        <td>
                                                            <b>
                                                                <elife:color color="red">b</elife:color>
                                                            </b>
                                                        </td>
                                                        <td>0.40%</td>
                                                        <td>±</td>
                                                        <td>0.40%</td>
                                                        <td>3.02%</td>
                                                        <td>±</td>
                                                        <td>1.42%</td>
                                                        <td>0.73%</td>
                                                        <td>±</td>
                                                        <td>0.31%</td>
                                                        <td>0.66%</td>
                                                        <td>±</td>
                                                        <td>0.37%</td>
                                                        <td>—</td>
                                                    </tr>
                                                </tbody>
                                                <!--<table-wrap-foot>
                                                    <fn>
                                                        <p>Footnotes not linked to content within the table text are
                                                            usually to define abbreviations. For example:</p>
                                                        <p>WT, wild type.</p>
                                                    </fn>
                                                </table-wrap-foot>-->
                                            </table>
                                        </asset>
                                    </figure>
                                    <p>
                                        <a href="#table2">Table 2</a>
                                        is an example of a standard table that will be
                                        the width of the text column in the PDF. It does not contain any unusual
                                        styling. It does have footnotes linked to content in the table using the
                                        prescribed symbols.
                                    </p>
                                    <figure>
                                        <asset>
                                            <label>Table 2.</label>
                                            <table-group id="table2">
                                                <doi>10.7554/eLife.00666.004</doi>
                                                <caption>
                                                    <p>This table contains references and footnotes and is sized to
                                                        the text column width in the PDF.
                                                    </p>
                                                </caption>
                                                <table>
                                                    <thead>
                                                        <tr>
                                                            <th rowspan="2">Protein</th>
                                                            <th rowspan="2">Molar ratio of lipid:protein in RPL
                                                                reactions
                                                                <a href="#tablefn1">*</a>
                                                            </th>
                                                            <th colspan="2">Molar ratio of lipid:protein on
                                                                vacuoles
                                                            </th>
                                                            <th rowspan="2">References
                                                                <a href="#tablefn2">†</a>
                                                            </th>
                                                        </tr>
                                                        <tr>
                                                            <th>BJ3505</th>
                                                            <th>DKY6218</th>
                                                        </tr>
                                                    </thead>
                                                    <tbody>
                                                        <tr>
                                                            <td elife:background-color="blue">Vam7p</td>
                                                            <td elife:background-color="green">2 × 10
                                                                <sup>3</sup>
                                                            </td>
                                                            <td elife:background-color="orange">30 × 10
                                                                <sup>4</sup>
                                                            </td>
                                                            <td elife:background-color="yellow">6.5 × 10
                                                                <sup>4</sup>
                                                            </td>
                                                            <td>
                                                                <a href="#bib12">DeLano, 2002</a>
                                                            </td>
                                                        </tr>
                                                        <tr>
                                                            <td elife:background-color="purple">Vam3p</td>
                                                            <td elife:background-color="red">2 × 10
                                                                <sup>3</sup>
                                                            </td>
                                                            <td elife:background-color="pink">11 × 10
                                                                <sup>4</sup>
                                                            </td>
                                                            <td elife:background-color="grey">22 × 10
                                                                <sup>4</sup>
                                                            </td>
                                                            <td>
                                                                <a href="#bib13">Department of Education and Morgan,
                                                                    2016
                                                                </a>
                                                            </td>
                                                        </tr>
                                                        <tr>
                                                            <td>Vti1p</td>
                                                            <td>2 × 10
                                                                <sup>3</sup>
                                                            </td>
                                                            <td>10 × 10
                                                                <sup>4</sup>
                                                            </td>
                                                            <td>13 × 10
                                                                <sup>4</sup>
                                                            </td>
                                                            <td>
                                                                <a href="#bib54">Zhong et al., 2013</a>
                                                            </td>
                                                        </tr>
                                                        <tr>
                                                            <td>Nyv1p</td>
                                                            <td>2 × 10
                                                                <sup>3</sup>
                                                            </td>
                                                            <td>4.3 × 10
                                                                <sup>4</sup>
                                                            </td>
                                                            <td>8.1 × 10
                                                                <sup>4</sup>
                                                            </td>
                                                            <td>
                                                                <a href="#bib16">Ferry et al., 2014</a>
                                                            </td>
                                                        </tr>
                                                    </tbody>
                                                </table>
                                                <table>
                                                    <thead>
                                                        <tr>
                                                            <th rowspan="2">Protein</th>
                                                            <th rowspan="2">Molar ratio of lipid:protein in RPL
                                                                reactions
                                                                <a href="#tablefn1">*</a>
                                                            </th>
                                                            <th colspan="2">Molar ratio of lipid:protein on
                                                                vacuoles
                                                            </th>
                                                            <th rowspan="2">References
                                                                <a href="#tablefn2">†</a>
                                                            </th>
                                                        </tr>
                                                    </thead>
                                                    <tbody>
                                                        <tr>
                                                            <td>Ypt7p</td>
                                                            <td>4 × 10
                                                                <sup>3</sup>
                                                            </td>
                                                            <td>1.9 × 10
                                                                <sup>4</sup>
                                                            </td>
                                                            <td>1.8 × 10
                                                                <sup>4</sup>
                                                            </td>
                                                            <td>
                                                                <a href="#bib54">Zhong et al., 2013</a>
                                                            </td>
                                                        </tr>
                                                        <tr>
                                                            <td>Sec17p</td>
                                                            <td>7 × 10
                                                                <sup>3</sup>
                                                            </td>
                                                            <td>41 × 10
                                                                <sup>4</sup>
                                                            </td>
                                                            <td>13 × 10
                                                                <sup>4</sup>
                                                            </td>
                                                            <td>
                                                                <a href="#bib51">Wolski et al., 2008</a>
                                                            </td>
                                                        </tr>
                                                        <tr>
                                                            <td>Sec18p</td>
                                                            <td>1 × 10
                                                                <sup>3</sup>
                                                            </td>
                                                            <td>10 × 10
                                                                <sup>4</sup>
                                                            </td>
                                                            <td>13 × 10
                                                                <sup>4</sup>
                                                            </td>
                                                            <td>This article (<a href="#fig1">Figure 1</a>)
                                                            </td>
                                                        </tr>
                                                        <tr>
                                                            <td>Vps33p</td>
                                                            <td>6 × 10
                                                                <sup>3</sup>
                                                            </td>
                                                            <td>17 × 10
                                                                <sup>4</sup>
                                                            </td>
                                                            <td>31 × 10
                                                                <sup>4</sup>
                                                            </td>
                                                            <td>
                                                                <a href="#bib54">Zhong et al., 2013</a>
                                                            </td>
                                                        </tr>
                                                    </tbody>
                                                </table>
                                                <!--<table-wrap-foot>
                                                    <fn id="tablefn1">
                                                        <label>*</label>
                                                        <p>Footnotes can be used to highlight properties of data
                                                            reported in a table such as statistical significance.
                                                            They are separate from the table caption and appear
                                                            afterwards. They are hyperlinked to allow easy
                                                            navigation. Footnotes in tables use the same standard
                                                            set of symbols used for authors footnotes.</p>
                                                    </fn>
                                                    <fn id="tablefn2">
                                                        <label>†</label>
                                                        <p>Authors are fully allowed to cite references and figures
                                                            in tables. There is no difference in citation style
                                                            between the main text and tables.</p>
                                                    </fn>
                                                    <fn>
                                                        <p>Order: Designated footnotes (e.g. &#x2a;, &#x2020;,
                                                            &#x2021;, &#167;, &#035;, &#182;, &#x2a;&#x2a;, and so
                                                            on), p value footnotes (&#x2a;p, &#x2a;&#x2a;p,
                                                            &#x2a;&#x2a;&#x2a;p), undesignated footnotes and
                                                            abbreviations.</p>
                                                    </fn>
                                                </table-wrap-foot>-->
                                            </table-group>
                                        </asset>
                                    </figure>
                                    <p>
                                        <a href="#table3">Table 3</a>
                                        is an example of a narrow table that will
                                        appear at half the text column width in the PDF. It also has source
                                        data.
                                    </p>
                                    <figure>
                                        <asset>
                                            <label>Table 3.</label>
                                            <table id="table3">
                                                <doi>10.7554/eLife.00666.005</doi>
                                                <tbody>
                                                    <tr>
                                                        <td colspan="2">Data collection</td>
                                                    </tr>
                                                    <tr>
                                                        <td> Space group</td>
                                                        <td>P6
                                                            <sub>2</sub>
                                                        </td>
                                                    </tr>
                                                    <tr>
                                                        <td rowspan="2">Cell dimensions (Å)</td>
                                                        <td>a = b = 78.33, c = 62.32</td>
                                                    </tr>
                                                    <tr>
                                                        <td>α = β = 90<sup>o</sup>, γ = 120
                                                            <sup>o</sup>
                                                        </td>
                                                    </tr>
                                                    <tr>
                                                        <td> Wavelength (Å)</td>
                                                        <td>0.9794</td>
                                                    </tr>
                                                    <tr>
                                                        <td> R<sub>sym</sub> or R<sub>merge</sub> (%)
                                                        </td>
                                                        <td>8.4</td>
                                                    </tr>
                                                    <tr>
                                                        <td> Resolution (Å)</td>
                                                        <td>
                                                            <monospace>50–2.05 (2.09–2.05)</monospace>
                                                        </td>
                                                    </tr>
                                                    <tr>
                                                        <td> I/σI</td>
                                                        <td>19.19 (3.23)</td>
                                                    </tr>
                                                    <tr>
                                                        <td> Completeness (%)</td>
                                                        <td>
                                                            <monospace>99.8 (97.3)</monospace>
                                                        </td>
                                                    </tr>
                                                    <tr>
                                                        <td> Redundancy</td>
                                                        <td>6.2 (5.4)</td>
                                                    </tr>
                                                    <tr>
                                                        <td colspan="2">Refinement</td>
                                                    </tr>
                                                    <tr>
                                                        <td> No. reflections</td>
                                                        <td>12,206</td>
                                                    </tr>
                                                    <tr>
                                                        <td> Resolution (Å)</td>
                                                        <td>
                                                            <monospace>39.17–2.06 (2.14–2.06)</monospace>
                                                        </td>
                                                    </tr>
                                                    <tr>
                                                        <td> R<sub>work</sub>/R
                                                            <sub>free</sub>
                                                        </td>
                                                        <td>
                                                            <monospace>0.17/0.21 (0.16/0.19)</monospace>
                                                        </td>
                                                    </tr>
                                                    <tr>
                                                        <td> No. atoms</td>
                                                        <td/>
                                                    </tr>
                                                    <tr>
                                                        <td>Protein</td>
                                                        <td>1608</td>
                                                    </tr>
                                                    <tr>
                                                        <td>Ligand/ion</td>
                                                        <td>3</td>
                                                    </tr>
                                                    <tr>
                                                        <td>Water</td>
                                                        <td>61</td>
                                                    </tr>
                                                    <tr>
                                                        <td> R.m.s. deviations</td>
                                                        <td/>
                                                    </tr>
                                                    <tr>
                                                        <td> Bond lengths (Å)</td>
                                                        <td>0.0077</td>
                                                    </tr>
                                                    <tr>
                                                        <td> Bond angles (°)</td>
                                                        <td>0.932</td>
                                                    </tr>
                                                </tbody>
                                            </table>
                                            <file id="table3sdata1">
                                                <doi>10.7554/eLife.00666.006</doi>
                                                <label>Table 3—source data 1.</label>
                                                <title>Representative curves of steady-state kinetic analyses for
                                                    each IGF1R protein characterized.
                                                </title>
                                                <caption>
                                                    <p>Each data point was performed in duplicate and is shown
                                                        separately.
                                                    </p>
                                                </caption>
                                                <source
                                                        media-type="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet"
                                                >
                                                    https://s3-external-1.amazonaws.com/continuumtest-elife-published/articles/00666/elife-00666-table3-data1.xlsx
                                                </source>
                                            </file>
                                        </asset>
                                    </figure>
                                    <p>The following unnamed table is an example of an inline table that has no
                                        heading.
                                    </p>
                                    <table id="inlinetable1">
                                        <thead>
                                            <tr>
                                                <th/>
                                                <th>pY</th>
                                                <th>Experiment</th>
                                                <th>Concentration (μM)</th>
                                            </tr>
                                        </thead>
                                        <tbody>
                                            <tr>
                                                <td>IGF1R-fl + IGF1</td>
                                                <td>+</td>
                                                <td>
                                                    <i>K</i>
                                                    <sub>
                                                        <i>m</i>
                                                    </sub>
                                                    ATP
                                                </td>
                                                <td>500, 400, 300, 250, 125, 62.5, 31.3, 15.6, 7.8</td>
                                            </tr>
                                            <tr>
                                                <td>IGF1R-fl + IGF1</td>
                                                <td>+</td>
                                                <td>
                                                    <i>K</i>
                                                    <sub>
                                                        <i>m</i>
                                                    </sub>
                                                    Peptide
                                                </td>
                                                <td>600, 300, 150, 75, 37.5, 18.8, 9.4</td>
                                            </tr>
                                            <tr>
                                                <td>IGF1R-fl + IGF1</td>
                                                <td>−</td>
                                                <td>
                                                    <i>K</i>
                                                    <sub>
                                                        <i>m</i>
                                                    </sub>
                                                    ATP
                                                </td>
                                                <td>2000, 1000, 500, 250, 125, 62.5, 31.3, 15.6, 7.8</td>
                                            </tr>
                                            <tr>
                                                <td>IGF1R-fl + IGF1</td>
                                                <td>−</td>
                                                <td>
                                                    <i>K</i>
                                                    <sub>
                                                        <i>m</i>
                                                    </sub>
                                                    Peptide
                                                </td>
                                                <td>500, 250, 125, 62.5, 31.3, 15.6, 7.8, 3.9</td>
                                            </tr>
                                            <tr>
                                                <td>IGF1R-fl</td>
                                                <td>+</td>
                                                <td>
                                                    <i>K</i>
                                                    <sub>
                                                        <i>m</i>
                                                    </sub>
                                                    ATP
                                                </td>
                                                <td>500, 400, 300, 250, 125, 62.5, 31.3, 15.6, 7.8</td>
                                            </tr>
                                            <tr>
                                                <td>IGF1R-fl</td>
                                                <td>+</td>
                                                <td>
                                                    <i>K</i>
                                                    <sub>
                                                        <i>m</i>
                                                    </sub>
                                                    Peptide
                                                </td>
                                                <td>500, 400, 250, 125, 62.5, 31.3, 15.6, 7.8</td>
                                            </tr>
                                            <tr>
                                                <td>IGF1R-fl</td>
                                                <td>−</td>
                                                <td>
                                                    <i>K</i>
                                                    <sub>
                                                        <i>m</i>
                                                    </sub>
                                                    ATP
                                                </td>
                                                <td>1000, 500, 250, 125, 62.5, 31.3, 15.6, 7.8</td>
                                            </tr>
                                            <tr>
                                                <td>IGF1R-fl</td>
                                                <td>−</td>
                                                <td>
                                                    <i>K</i>
                                                    <sub>
                                                        <i>m</i>
                                                    </sub>
                                                    Peptide
                                                </td>
                                                <td>1000, 500, 250, 125, 62.5, 31.3, 15.6</td>
                                            </tr>
                                            <tr>
                                                <td>IGF1R-icd</td>
                                                <td>+</td>
                                                <td>
                                                    <i>K</i>
                                                    <sub>
                                                        <i>m</i>
                                                    </sub>
                                                    ATP
                                                </td>
                                                <td>500, 250, 125, 62.5, 31.3, 15.6, 7.8, 3.9</td>
                                            </tr>
                                            <tr>
                                                <td>IGF1R-icd</td>
                                                <td>+</td>
                                                <td>
                                                    <i>K</i>
                                                    <sub>
                                                        <i>m</i>
                                                    </sub>
                                                    Peptide
                                                </td>
                                                <td>1000, 500, 250, 125, 62.5, 31.3, 15.6, 7.8</td>
                                            </tr>
                                            <tr>
                                                <td>IGF1R-icd</td>
                                                <td>−</td>
                                                <td>
                                                    <i>K</i>
                                                    <sub>
                                                        <i>m</i>
                                                    </sub>
                                                    ATP
                                                </td>
                                                <td>1000, 500, 250, 125, 62.5, 31.3</td>
                                            </tr>
                                            <tr>
                                                <td>IGF1R-icd</td>
                                                <td>−</td>
                                                <td>
                                                    <i>K</i>
                                                    <sub>
                                                        <i>m</i>
                                                    </sub>
                                                    Peptide
                                                </td>
                                                <td>1000, 500, 250, 125, 62.5, 31.3</td>
                                            </tr>
                                            <tr>
                                                <td>IGF1R-kin</td>
                                                <td>−</td>
                                                <td>
                                                    <i>K</i>
                                                    <sub>
                                                        <i>m</i>
                                                    </sub>
                                                    Peptide
                                                </td>
                                                <td>1250, 625, 312.5, 156.3, 78.1, 39.1</td>
                                            </tr>
                                        </tbody>
                                        <!--<table-wrap-foot>
                                            <fn>
                                                <p>This is an unmarked footnote for an anchored/inline table</p>
                                            </fn>
                                        </table-wrap-foot>-->
                                    </table>
                                </content>
                            </section>
                            <section id="s2-3">
                                <title>Maths</title>
                                <content>
                                    <p>Content can contain inline formulae or display formulae. Below is an example
                                        of a mixture of inline and display formula. MathMl is used in all
                                        instances.
                                    </p>
                                    <p>We propose a Bayesian scheme for BCV (see <a href="#equ1">equation 1</a>)
                                        that accommodates the influence of context on incentive value. BCV focuses
                                        on scenarios (i) where incentive value depends on contextual information
                                        (either represented by cues or by previous rewards) provided before options
                                        or rewards are presented, and (ii) where reward is defined by a single
                                        attribute (e.g., reward amount). To describe the basic principles of BCV, we
                                        adopt the formalism of Bayesian graphs (
                                        <a href="#bib47">The
                                            <i>Shigella</i>
                                            Genome Sequencing Consortium, 2015c
                                        </a>
                                        ) where a
                                        generative model is described by nodes or circles, representing random
                                        variables (shaded and white circles refer to observed and non-observed
                                        variables respectively), and arrows, representing causal relationships among
                                        variables. A simple generative model hypothesized by BCV is shown in Figure
                                        1A of another article (not linked here), where C represents prior beliefs
                                        about the average reward expected in a given context. Formally, this
                                        corresponds to a (Gaussian) prior belief (with mean
                                        <mml:math>
                                            <mml:mstyle displaystyle="true" scriptlevel="0">
                                                <mml:mrow>
                                                    <mml:msub>
                                                        <mml:mi>μ</mml:mi>
                                                        <mml:mrow>
                                                            <mml:mi>c</mml:mi>
                                                        </mml:mrow>
                                                    </mml:msub>
                                                </mml:mrow>
                                            </mml:mstyle>
                                        </mml:math>
                                        and variance
                                        <mml:math>
                                            <mml:mstyle displaystyle="true" scriptlevel="0">
                                                <mml:mrow>
                                                    <mml:msubsup>
                                                        <mml:mi>σ</mml:mi>
                                                        <mml:mrow>
                                                            <mml:mi>c</mml:mi>
                                                        </mml:mrow>
                                                        <mml:mrow>
                                                            <mml:mn>2</mml:mn>
                                                        </mml:mrow>
                                                    </mml:msubsup>
                                                </mml:mrow>
                                            </mml:mstyle>
                                        </mml:math>
                                        over the mean of a (Gaussian) distribution of reward options R
                                        (with variance
                                        <mml:math>
                                            <mml:mstyle displaystyle="true" scriptlevel="0">
                                                <mml:mrow>
                                                    <mml:msubsup>
                                                        <mml:mi>σ</mml:mi>
                                                        <mml:mrow>
                                                            <mml:mi>R</mml:mi>
                                                        </mml:mrow>
                                                        <mml:mrow>
                                                            <mml:mn>2</mml:mn>
                                                        </mml:mrow>
                                                    </mml:msubsup>
                                                </mml:mrow>
                                            </mml:mstyle>
                                        </mml:math>
                                        ). When R is observed, a posterior expectation about the context
                                        is obtained by application of Bayes rule (
                                        <a href="#bib46">The
                                            <i>Shigella</i>
                                            Genome Sequencing Consortium, 2015b
                                        </a>
                                        ):
                                    </p>
                                    <mathml id="equ3">
                                        <label>(3)</label>
                                        <mml:math id="m1">
                                            <mml:mstyle displaystyle="true" scriptlevel="0">
                                                <mml:mrow>
                                                    <mml:msub>
                                                        <mml:mi>μ</mml:mi>
                                                        <mml:mrow>
                                                            <mml:mi>C</mml:mi>
                                                            <mml:mrow>
                                                                <mml:mo stretchy="false">|</mml:mo>
                                                            </mml:mrow>
                                                            <mml:mi>R</mml:mi>
                                                        </mml:mrow>
                                                    </mml:msub>
                                                    <mml:mo>=</mml:mo>
                                                    <mml:msub>
                                                        <mml:mi>μ</mml:mi>
                                                        <mml:mrow>
                                                            <mml:mi>C</mml:mi>
                                                        </mml:mrow>
                                                    </mml:msub>
                                                    <mml:mo>+</mml:mo>
                                                    <mml:mfrac>
                                                        <mml:msubsup>
                                                            <mml:mi>σ</mml:mi>
                                                            <mml:mrow>
                                                                <mml:mi>C</mml:mi>
                                                            </mml:mrow>
                                                            <mml:mrow>
                                                                <mml:mn>2</mml:mn>
                                                            </mml:mrow>
                                                        </mml:msubsup>
                                                        <mml:mrow>
                                                            <mml:msubsup>
                                                                <mml:mi>σ</mml:mi>
                                                                <mml:mrow>
                                                                    <mml:mi>C</mml:mi>
                                                                </mml:mrow>
                                                                <mml:mrow>
                                                                    <mml:mn>2</mml:mn>
                                                                </mml:mrow>
                                                            </mml:msubsup>
                                                            <mml:mo>+</mml:mo>
                                                            <mml:msubsup>
                                                                <mml:mi>σ</mml:mi>
                                                                <mml:mrow>
                                                                    <mml:mi>R</mml:mi>
                                                                </mml:mrow>
                                                                <mml:mrow>
                                                                    <mml:mn>2</mml:mn>
                                                                </mml:mrow>
                                                            </mml:msubsup>
                                                        </mml:mrow>
                                                    </mml:mfrac>
                                                    <mml:mrow>
                                                        <mml:mo>(</mml:mo>
                                                        <mml:mi>R</mml:mi>
                                                        <mml:mo>−</mml:mo>
                                                        <mml:msub>
                                                            <mml:mi>μ</mml:mi>
                                                            <mml:mrow>
                                                                <mml:mi>C</mml:mi>
                                                            </mml:mrow>
                                                        </mml:msub>
                                                        <mml:mo>)</mml:mo>
                                                    </mml:mrow>
                                                </mml:mrow>
                                            </mml:mstyle>
                                        </mml:math>
                                    </mathml>
                                    <p>where text following on from this equation but still within the same
                                        paragraph should not be indented in the PDF. This is usually used by authors
                                        wanting to explain the terms used in the maths.
                                    </p>
                                    <p>Additional to maths, eLife articles can also contain code blocks for the
                                        display of computer code snipets. For example:
                                    </p>
                                    <code xml:space="preserve">&lt;MotifGraft name=&quot;motif_grafting&quot;
      context_structure=&quot;%%context%%&quot;
      motif_structure=&quot;truncatedBH3.pdb&quot;
      RMSD_tolerance=&quot;3.0&quot;
      NC_points_RMSD_tolerance=&quot;2.0&quot;
      clash_score_cutoff=&quot;0&quot;
      clash_test_residue=&quot;ALA&quot;
      hotspots=&quot;9:12:13:14:16:17&quot;
      combinatory_fragment_size_delta=&quot;0:0&quot;
      max_fragment_replacement_size_delta=&quot;0:0&quot;
      full_motif_bb_alignment=&quot;1&quot;
      allow_independent_alignment_per_fragment=&quot;0&quot;
      graft_only_hotspots_by_replacement=&quot;0&quot;
      only_allow_if_N_point_match_aa_identity=&quot;0&quot;
      only_allow_if_C_point_match_aa_identity=&quot;0&quot;
      revert_graft_to_native_sequence=&quot;1&quot;
      allow_repeat_same_graft_output=&quot;1&quot;/&gt;</code>
                                </content>
                            </section>
                            <section id="s2-4">
                                <title>Figures</title>
                                <content>
                                    <p>This section of the article shows how figures should be presented and will
                                        include examples of single figures and figures arranged with a variety of
                                        additional assets.
                                    </p>
                                    <p>
                                        <a href="#fig1">Figure 1</a>
                                        is an example of a single figure.
                                    </p>
                                    <figure>
                                        <asset>
                                            <label>Figure 1.</label>
                                            <image id="fig1">
                                                <doi>10.7554/eLife.00666.007</doi>
                                                <title>Single figure: The header of an eLife article example on the
                                                    HTML page. In the PDf this is represented as a single
                                                    column.
                                                </title>
                                                <source height="634" width="838" media-type="image/tiff"
                                                >
                                                    https://s3-external-1.amazonaws.com/continuumtest-elife-published/articles/00666/eLife-00666-fig1-v9.tif
                                                </source>
                                                <variant height="634" width="838" media-type="image/jpeg"
                                                >
                                                    https://s3-external-1.amazonaws.com/continuumtest-elife-published/articles/00666/eLife-00666-fig1-v9.jpg
                                                </variant>
                                                <iiif:info>
                                                    https://continuumtest--cdn-iiif.elifesciences.org/lax:00666/eLife-00666-fig1-v9.tif/info.json
                                                </iiif:info>
                                                <!--<permissions>
                                                    <copyright-statement>&#x00A9; 2016 eLife. All rights
                                                        reserved</copyright-statement>
                                                    <copyright-year>2016</copyright-year>
                                                    <copyright-holder>eLife</copyright-holder>
                                                    <license>
                                                        <license-p>For the purpose having a example of how to tag a
                                                            separate license for an item, we have indicated in the
                                                            XML and display this is a copyrighted figure; however it
                                                            is not.</license-p>
                                                    </license>
                                                </permissions>-->
                                            </image>
                                        </asset>
                                    </figure>
                                    <p>
                                        <a href="#fig2">Figure 2</a>
                                        is an example of a figure with figure
                                        supplements, <a href="#fig2s1">Figure 2—figure supplement 1</a> and <a
                                            href="#fig2s2">Figure 2—figure supplement 2</a>.
                                    </p>
                                    <figure>
                                        <asset>
                                            <label>Figure 2.</label>
                                            <image id="fig2">
                                                <doi>10.7554/eLife.00666.008</doi>
                                                <title>Figure with figure supplements. In the PDF this asset box
                                                    will take full column width.
                                                </title>
                                                <caption>
                                                    <p>This is the basic information provided about an article. <a
                                                            href="#fig1">Figure 1
                                                    </a> shows an expanded view (<a
                                                            href="#bib26">Kok et al., 2015</a>; <a href="#bib28"
                                                    >National Institute of Mental Health, 1990</a>).
                                                    </p>
                                                </caption>
                                                <source height="441" width="412" media-type="image/tiff"
                                                >
                                                    https://s3-external-1.amazonaws.com/continuumtest-elife-published/articles/00666/eLife-00666-fig2-v9.tif
                                                </source>
                                                <variant height="441" width="412" media-type="image/jpeg"
                                                >
                                                    https://s3-external-1.amazonaws.com/continuumtest-elife-published/articles/00666/eLife-00666-fig2-v9.jpg
                                                </variant>
                                                <iiif:info>
                                                    https://continuumtest--cdn-iiif.elifesciences.org/lax:00666/eLife-00666-fig2-v9.tif/info.json
                                                </iiif:info>
                                            </image>
                                        </asset>
                                        <asset>
                                            <label>Figure 2—figure supplement 1.</label>
                                            <image id="fig2s1">
                                                <doi>10.7554/eLife.00666.009</doi>
                                                <title>The representation of the Major Subject Areas, Research
                                                    Organisms and author keywords on the eLife HTML page
                                                </title>
                                                <source height="106" width="383" media-type="image/tiff"
                                                >
                                                    https://s3-external-1.amazonaws.com/continuumtest-elife-published/articles/00666/eLife-00666-fig2-figsupp1-v9.tif
                                                </source>
                                                <variant height="106" width="383" media-type="image/jpeg"
                                                >
                                                    https://s3-external-1.amazonaws.com/continuumtest-elife-published/articles/00666/eLife-00666-fig2-figsupp1-v9.jpg
                                                </variant>
                                                <iiif:info>
                                                    https://continuumtest--cdn-iiif.elifesciences.org/lax:00666/eLife-00666-fig2-figsupp1-v9.tif/info.json
                                                </iiif:info>
                                            </image>
                                        </asset>
                                        <asset>
                                            <label>Figure 2—figure supplement 2.</label>
                                            <image id="fig2s2">
                                                <doi>10.7554/eLife.00666.010</doi>
                                                <title>Representation of figure with figure supplements on the HTML
                                                    view.
                                                </title>
                                                <source height="486" width="334" media-type="image/tiff"
                                                >
                                                    https://s3-external-1.amazonaws.com/continuumtest-elife-published/articles/00666/eLife-00666-fig2-figsupp2-v9.tif
                                                </source>
                                                <variant height="486" width="334" media-type="image/jpeg"
                                                >
                                                    https://s3-external-1.amazonaws.com/continuumtest-elife-published/articles/00666/eLife-00666-fig2-figsupp2-v9.jpg
                                                </variant>
                                                <iiif:info>
                                                    https://continuumtest--cdn-iiif.elifesciences.org/lax:00666/eLife-00666-fig2-figsupp2-v9.tif/info.json
                                                </iiif:info>
                                            </image>
                                        </asset>
                                    </figure>
                                    <p>
                                        <a href="#fig3">Figure 3</a>
                                        is an example of a figure with a figure
                                        supplement (<a href="#fig3s1">Figure 3—figure supplement 1</a>) with two
                                        sub-assets, <a href="#fig3sdata1">Figure 3—figure supplement 1—source data
                                        1
                                    </a> and <a href="#fig3video1">Figure 3—video 1</a> (see <a
                                            href="#bib53">Zhang et al., 2010</a>, <a href="#bib54">Zhong et al.,
                                        2013</a>; <a href="#bib52">World Health Organization, 2016</a>).
                                    </p>
                                    <figure>
                                        <asset>
                                            <label>Figure 3.</label>
                                            <image id="fig3">
                                                <doi>10.7554/eLife.00666.011</doi>
                                                <title>Figure with figure supplements and figure supplement with
                                                    source data and a video <!--(see <a href="#bib25">Koch, 1959</a>)-->
                                                    .
                                                </title>
                                                <source height="246" width="440" media-type="image/tiff"
                                                >
                                                    https://s3-external-1.amazonaws.com/continuumtest-elife-published/articles/00666/eLife-00666-fig3-v9.tif
                                                </source>
                                                <variant height="246" width="440" media-type="image/jpeg"
                                                >
                                                    https://s3-external-1.amazonaws.com/continuumtest-elife-published/articles/00666/eLife-00666-fig3-v9.jpg
                                                </variant>
                                                <iiif:info>
                                                    https://continuumtest--cdn-iiif.elifesciences.org/lax:00666/eLife-00666-fig3-v9.tif/info.json
                                                </iiif:info>
                                            </image>
                                        </asset>
                                        <asset>
                                            <label>Figure 3—figure supplement 1.</label>
                                            <image id="fig3s1">
                                                <doi>10.7554/eLife.00666.012</doi>
                                                <title>Title of the figure supplement</title>
                                                <source height="551" width="1317" media-type="image/tiff"
                                                >
                                                    https://s3-external-1.amazonaws.com/continuumtest-elife-published/articles/00666/eLife-00666-fig3-figsupp1-v9.tif
                                                </source>
                                                <variant height="551" width="1317" media-type="image/jpeg"
                                                >
                                                    https://s3-external-1.amazonaws.com/continuumtest-elife-published/articles/00666/eLife-00666-fig3-figsupp1-v9.jpg
                                                </variant>
                                                <iiif:info>
                                                    https://continuumtest--cdn-iiif.elifesciences.org/lax:00666/eLife-00666-fig3-figsupp1-v9.tif/info.json
                                                </iiif:info>
                                            </image>
                                            <file id="fig3sdata1">
                                                <doi>10.7554/eLife.00666.013</doi>
                                                <label>Figure 3—figure supplement 1—source data 1.</label>
                                                <title>Title of the figure supplement source data.</title>
                                                <caption>
                                                    <p>Legend of the figure supplement source data.</p>
                                                </caption>
                                                <source
                                                        media-type="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet"
                                                >
                                                    https://s3-external-1.amazonaws.com/continuumtest-elife-published/articles/00666/elife-00666-fig3-figsupp1-data1.xlsx
                                                </source>
                                            </file>
                                        </asset>
                                        <asset>
                                            <label>Figure 3—video 1.</label>
                                            <video id="fig3video1">
                                                <doi>10.7554/eLife.00666.035</doi>
                                                <title>A description of the eLife editorial process.</title>
                                                <source height="720" width="1280"
                                                        media-type="video/mp4; codecs=&quot;avc1.42E01E, mp4a.40.2&quot;"
                                                >
                                                    https://static-movie-usa.glencoesoftware.com/mp4/10.7554/657/f42a609b0e61fc41798dcba3cc0c87598bd2cf9f/elife-00666-fig3-video1.mp4
                                                </source>
                                                <variant height="720" width="1280"
                                                         media-type="video/ogg; codecs=&quot;theora, vorbis&quot;"
                                                >
                                                    https://static-movie-usa.glencoesoftware.com/ogv/10.7554/657/f42a609b0e61fc41798dcba3cc0c87598bd2cf9f/elife-00666-fig3-video1.ogv
                                                </variant>
                                                <variant height="720" width="1280"
                                                         media-type="video/webm; codecs=&quot;vp8.0, vorbis&quot;"
                                                >
                                                    https://static-movie-usa.glencoesoftware.com/webm/10.7554/657/f42a609b0e61fc41798dcba3cc0c87598bd2cf9f/elife-00666-fig3-video1.webm
                                                </variant>
                                            </video>
                                        </asset>
                                    </figure>
                                    <p>
                                        <a href="#fig4">Figure 4</a>
                                        is an example of a figure with source code (<a
                                            href="#fig4scode1">Figure 4—source code 1</a>).
                                    </p>
                                    <figure>
                                        <asset>
                                            <label>Figure 4.</label>
                                            <image id="fig4">
                                                <doi>10.7554/eLife.00666.014</doi>
                                                <title>Single figure with source code.</title>
                                                <source height="439" width="590" media-type="image/tiff"
                                                >
                                                    https://s3-external-1.amazonaws.com/continuumtest-elife-published/articles/00666/eLife-00666-fig4-v9.tif
                                                </source>
                                                <variant height="439" width="590" media-type="image/jpeg"
                                                >
                                                    https://s3-external-1.amazonaws.com/continuumtest-elife-published/articles/00666/eLife-00666-fig4-v9.jpg
                                                </variant>
                                                <iiif:info>
                                                    https://continuumtest--cdn-iiif.elifesciences.org/lax:00666/eLife-00666-fig4-v9.tif/info.json
                                                </iiif:info>
                                            </image>
                                            <file id="fig4scode1">
                                                <doi>10.7554/eLife.00666.015</doi>
                                                <label>Figure 4—source code 1.</label>
                                                <title>Title of the source code.</title>
                                                <caption>
                                                    <p>Legend of the source code.</p>
                                                </caption>
                                                <source
                                                        media-type="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet"
                                                >
                                                    https://s3-external-1.amazonaws.com/continuumtest-elife-published/articles/00666/elife-00666-fig4-code1.xlsx
                                                </source>
                                            </file>
                                        </asset>
                                    </figure>
                                </content>
                            </section>
                            <section id="s2-5">
                                <title>Videos</title>
                                <content>
                                    <p>
                                        <a href="#video1">Video 1</a>
                                        shows the editorial process and <a
                                            href="#video2">Animation 1
                                    </a> shows how we represent animated gif
                                        files.
                                    </p>
                                    <figure>
                                        <asset>
                                            <label>Video 1.</label>
                                            <video id="video1">
                                                <doi>10.7554/eLife.00666.016</doi>
                                                <title>A description of the eLife editorial process.</title>
                                                <source height="720" width="1280"
                                                        media-type="video/mp4; codecs=&quot;avc1.42E01E, mp4a.40.2&quot;"
                                                >
                                                    https://static-movie-usa.glencoesoftware.com/mp4/10.7554/657/f42a609b0e61fc41798dcba3cc0c87598bd2cf9f/elife-00666-video1.mp4
                                                </source>
                                                <variant height="720" width="1280"
                                                         media-type="video/ogg; codecs=&quot;theora, vorbis&quot;"
                                                >
                                                    https://static-movie-usa.glencoesoftware.com/ogv/10.7554/657/f42a609b0e61fc41798dcba3cc0c87598bd2cf9f/elife-00666-video1.ogv
                                                </variant>
                                                <variant height="720" width="1280"
                                                         media-type="video/webm; codecs=&quot;vp8.0, vorbis&quot;"
                                                >
                                                    https://static-movie-usa.glencoesoftware.com/webm/10.7554/657/f42a609b0e61fc41798dcba3cc0c87598bd2cf9f/elife-00666-video1.webm
                                                </variant>
                                            </video>
                                            <file id="video1sdata1">
                                                <doi>10.7554/eLife.00666.037</doi>
                                                <label>Video 1—source data 1.</label>
                                                <title>Title of the source code.</title>
                                                <caption>
                                                    <p>Legend of the source code.</p>
                                                </caption>
                                                <source
                                                        media-type="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet"
                                                >
                                                    https://s3-external-1.amazonaws.com/continuumtest-elife-published/articles/00666/elife-00666-video1-data1.xlsx
                                                </source>
                                            </file>
                                        </asset>
                                    </figure>
                                    <figure>
                                        <asset>
                                            <label>Animation 1.</label>
                                            <video id="video2">
                                                <doi>10.7554/eLife.00666.038</doi>
                                                <title>A demonstration of how to tag an animated gif file to ensure
                                                    it is autolooped when on the eLife website.
                                                </title>
                                                <source height="834" width="669"
                                                        media-type="video/mp4; codecs=&quot;avc1.42E01E, mp4a.40.2&quot;"
                                                >
                                                    https://s3-external-1.amazonaws.com/continuumtest-elife-published/articles/00666/eLife-00666-video2-v5.gif
                                                </source>
                                                <variant height="834" width="669"
                                                         media-type="video/mp4; codecs=&quot;avc1.42E01E, mp4a.40.2&quot;"
                                                >
                                                    https://static-movie-usa.glencoesoftware.com/mp4/10.7554/657/f42a609b0e61fc41798dcba3cc0c87598bd2cf9f/elife-00666-video2.mp4
                                                </variant>
                                                <variant height="834" width="669"
                                                         media-type="video/ogg; codecs=&quot;theora, vorbis&quot;"
                                                >
                                                    https://static-movie-usa.glencoesoftware.com/ogv/10.7554/657/f42a609b0e61fc41798dcba3cc0c87598bd2cf9f/elife-00666-video2.ogv
                                                </variant>
                                                <variant height="834" width="669"
                                                         media-type="video/webm; codecs=&quot;vp8.0, vorbis&quot;"
                                                >
                                                    https://static-movie-usa.glencoesoftware.com/webm/10.7554/657/f42a609b0e61fc41798dcba3cc0c87598bd2cf9f/elife-00666-video2.webm
                                                </variant>
                                            </video>
                                        </asset>
                                    </figure>
                                </content>
                            </section>
                            <section id="s2-6">
                                <title>Other stuff</title>
                                <content>
                                    <section id="s2-6-1">
                                        <title>Boxes</title>
                                        <content>
                                            <p>It is rare for eLife research articles to contain boxes; however they
                                                are common in Feature content. <a href="#box1">Box 1</a> is a simple
                                                box that contains very little text and <a href="#box2">Box 2</a> is
                                                larger.
                                            </p>
                                            <aside id="box1">
                                                <doi>10.7554/eLife.00666.017</doi>
                                                <label>Box 1.</label>
                                                <caption>
                                                    <p>Example of a small box</p>
                                                </caption>
                                                <content>
                                                    <p>Donec rhoncus in odio non vulputate. Donec vitae enim at erat
                                                        tincidunt tincidunt in nec arcu. Pellentesque habitant morbi
                                                        tristique senectus et netus et malesuada fames ac turpis
                                                        egestas. Aliquam id nunc id arcu maximus rutrum. Praesent
                                                        bibendum nisl orci, ac sollicitudin purus aliquam in. Duis
                                                        eu fermentum arcu. Fusce eget dolor augue. Nulla facilisi.
                                                        Suspendisse eu nisl vitae neque ullamcorper imperdiet (see
                                                        <a href="#bib29">Nellåker, 2014</a>; <a href="#bib30">
                                                            Pages et al., 2014</a>; and <a href="#bib31">Palmer et
                                                            al., 2007</a>). Boxes, like main text, can contain <a
                                                                href="https://elifesciences.org/about">hyperlinks
                                                        </a> at
                                                        any point. Etiam in sem augue.
                                                    </p>
                                                </content>
                                                <!--<permissions>
                                                    <copyright-statement>&#x00A9; Some author</copyright-statement>
                                                    <copyright-year>1998</copyright-year>
                                                    <copyright-holder>Some Author</copyright-holder>
                                                    <license>
                                                        <license-p>Boxes are also allowed license statements, as
                                                            they can contain text that is repeated or adapted from
                                                            previously published content.</license-p>
                                                    </license>
                                                </permissions>-->
                                            </aside>
                                            <aside id="box2">
                                                <doi>10.7554/eLife.00666.018</doi>
                                                <label>Box 2.</label>
                                                <caption>
                                                    <p>Example of a large box</p>
                                                </caption>
                                                <content>
                                                    <p>This box contains a <a href="#box2fig1">figure</a>. Lorem
                                                        ipsum dolor sit amet, consectetur adipiscing elit. Quisque
                                                        vel rhoncus lorem. Suspendisse posuere non enim vel tempor.
                                                        Fusce quis sem sed nulla tincidunt faucibus. Vivamus dictum
                                                        magna in ante porttitor faucibus. Aenean lobortis, sem in
                                                        viverra dignissim, odio purus vestibulum libero, in eleifend
                                                        lacus metus id tortor. Phasellus tincidunt ipsum ut ornare
                                                        hendrerit. Praesent lobortis consectetur egestas. Curabitur
                                                        viverra lectus eu venenatis sagittis. Aliquam lobortis metus
                                                        mauris, in tincidunt diam ullamcorper ac. Phasellus
                                                        sagittis, leo eget lacinia commodo, eros justo mattis eros,
                                                        quis dapibus ipsum ex sit amet sapien. Quisque consequat
                                                        arcu ut efficitur tincidunt. Ut convallis, ex maximus
                                                        aliquam tempor, lorem elit fermentum ipsum, nec volutpat
                                                        velit sem a lectus. Morbi sed mauris vel purus interdum
                                                        consectetur dapibus vel velit. Nam pellentesque, ipsum vel
                                                        euismod mattis, turpis augue mattis nunc, ac aliquam dolor
                                                        massa non mi. Vestibulum sit amet elit a augue semper
                                                        facilisis interdum quis nibh. Mauris consectetur nisi
                                                        aliquam urna lobortis, eu efficitur nisl lobortis; <a
                                                                href="#bib2">Bates et al., 2016
                                                        </a> and <a href="#bib32"
                                                        >Patterson et al., 2011</a>.
                                                    </p>
                                                    <figure>
                                                        <asset>
                                                            <label>Box 2—Figure 1.</label>
                                                            <image id="box2fig1">
                                                                <doi>10.7554/eLife.00666.036</doi>
                                                                <title>Box figure</title>
                                                                <source height="524" width="857"
                                                                        media-type="image/tiff"
                                                                >
                                                                    https://s3-external-1.amazonaws.com/continuumtest-elife-published/articles/00666/eLife-00666-box2-fig1-v9.tif
                                                                </source>
                                                                <variant height="524" width="857"
                                                                         media-type="image/jpeg"
                                                                >
                                                                    https://s3-external-1.amazonaws.com/continuumtest-elife-published/articles/00666/eLife-00666-box2-fig1-v9.jpg
                                                                </variant>
                                                                <iiif:info>
                                                                    https://continuumtest--cdn-iiif.elifesciences.org/lax:00666/eLife-00666-box2-fig1-v9.tif/info.json
                                                                </iiif:info>
                                                            </image>
                                                        </asset>
                                                    </figure>
                                                    <p>Donec rhoncus in odio non vulputate. Donec vitae enim at erat
                                                        tincidunt tincidunt in nec arcu. Pellentesque habitant morbi
                                                        tristique senectus et netus et malesuada fames ac turpis
                                                        egestas. Aliquam id nunc id arcu maximus rutrum. Praesent
                                                        bibendum nisl orci, ac sollicitudin purus aliquam in. Duis
                                                        eu fermentum arcu. Fusce eget dolor augue. Nulla facilisi.
                                                        Suspendisse eu nisl vitae neque ullamcorper imperdiet.
                                                        Vestibulum ultrices vehicula nibh, a ullamcorper dui semper
                                                        suscipit. Etiam in sem augue.
                                                    </p>
                                                </content>
                                            </aside>
                                        </content>
                                    </section>
                                    <section id="s2-6-2">
                                        <title>RRIDs</title>
                                        <content>
                                            <p>If an author mentions an RRID in their content, it is required that
                                                we link it, for example, <a
                                                        href="https://scicrunch.org/resolver/RRID:IMSR_JAX:004435"
                                                >RRID:IMSR_JAX:004435</a>.
                                            </p>
                                        </content>
                                    </section>
                                    <section id="s2-6-3">
                                        <title>Coloured text</title>
                                        <content>
                                            <p>Here is an example of making text display in different colours:
                                                <elife:color color="blue">Blue text: #366BFB</elife:color>;
                                                <elife:color color="purple">Purple text: #9C27B0</elife:color>;
                                                and <elife:color color="red">Red text: #D50000</elife:color>.
                                            </p>
                                        </content>
                                    </section>
                                    <section id="s2-6-4">
                                        <title>Inline graphics</title>
                                        <content>
                                            <p>Here is an example of pulling in an inline graphic <!--<img
                                    src="https://continuumtest-cdn.elifesciences.org/articles/00666/eLife-00666-inf1-v9.jpg"/>
                                <inline-graphic mimetype="image" mime-subtype="jpeg"
                                                href="elife-00666-inf001.jpeg"/>-->.
                                            </p>
                                        </content>
                                    </section>
                                    <section id="s2-6-5">
                                        <title>Additional files</title>
                                        <content>
                                            <p>All files attached to an article must be cited in the main text as
                                                well. So, <a href="#supp1">Supplementary file 1</a> and <a
                                                        href="#sdata1">Source data 1
                                                </a> have to be cited in the
                                                text.
                                            </p>
                                        </content>
                                    </section>
                                    <section id="s2-6-6">
                                        <title>References</title>
                                        <content>
                                            <p>All references have to be cited in the main text. They are listed in
                                                the reference list in alphabetical order, however, in the text the
                                                citations do not have to be in the same order as they are listed
                                                according to when the author of the article cites them. This article
                                                is littered with citations to ensure all the references are cited at
                                                some point. They have no relevance to the content <a href="#bib1"
                                                >Aivazian et al., 2006</a>.
                                            </p>
                                        </content>
                                    </section>
                                </content>
                            </section>
                        </content>
                    </section>
                    <section id="s3">
                        <title>Discussion</title>
                        <content>
                            <p>The function of the Discussion is to interpret your results in light of what was
                                already known about the subject of the investigation, and to explain our new
                                understanding of the problem after taking your results into consideration. The
                                Discussion will always connect to the Introduction by way of the question(s) or
                                hypotheses you posed and the literature you cited, but it does not simply repeat or
                                rearrange the Introduction. Instead, it tells how your study has moved us forward
                                from the place you left us at the end of the Introduction (<a href="#bib38"
                                >Schneider, 2006</a>; <a href="#bib40">Schwartz, 1993</a>).
                            </p>
                        </content>
                    </section>
                    <section id="s4">
                        <title>Materials and methods</title>
                        <content>
                            <figure>
                                <asset>
                                    <label>Key resources table</label>
                                    <table id="keyresource">
                                        <thead>
                                            <tr>
                                                <th>Reagent type <!--<break/>-->(species) or resource</th>
                                                <th>Designation</th>
                                                <th>Source or reference</th>
                                                <th>Identifiers</th>
                                                <th>Additional <!--<break/>-->information</th>
                                            </tr>
                                        </thead>
                                        <tbody>
                                            <tr>
                                                <td>gene (<i>Drosophila melanogaster</i>)
                                                </td>
                                                <td>nito</td>
                                                <td>NA</td>
                                                <td>FLYB:FBgn0027548</td>
                                                <td>&#x00A0;</td>
                                            </tr>
                                            <tr>
                                                <td>gene (<i>D. melanogaste</i>r)
                                                </td>
                                                <td>Sxl</td>
                                                <td>NA</td>
                                                <td>FLYB:FBgn0264270</td>
                                                <td>&#x00A0;</td>
                                            </tr>
                                            <tr>
                                                <td>genetic reagent (D. melanogaster)</td>
                                                <td>MTD-Gal4</td>
                                                <td>Bloomington Drosophila Stock Center</td>
                                                <td>BDSC:31777; FLYB:FBtp0001612; RRID:
                                                    <a
                                                            href="https://scicrunch.org/resolver/BDSC_31777"
                                                    >BDSC_31777
                                                    </a>
                                                </td>
                                                <td>FlyBase symbol: P{GAL4-nos.NGT}</td>
                                            </tr>
                                            <tr>
                                                <td>genetic reagent (<i>D. melanogaster</i>)
                                                </td>
                                                <td>ap-Gal4</td>
                                                <td>Bloomington Drosophila Stock Center</td>
                                                <td>BDSC:3041; FLYB:FBti0002785; RRID:
                                                    <a
                                                            href="https://scicrunch.org/resolver/BDSC_3041"
                                                    >BDSC_3041
                                                    </a>
                                                </td>
                                                <td>FlyBase symbol: P{GawB}ap[md544]</td>
                                            </tr>
                                            <tr>
                                                <td>genetic reagent (<i>D. melanogaster</i>)
                                                </td>
                                                <td>nub-Gal4</td>
                                                <td>PMID:20798049</td>
                                                <td>FLYB:FBti0016825</td>
                                                <td>FlyBase symbol: P{GawB}nubbin-AC-62</td>
                                            </tr>
                                            <tr>
                                                <td>genetic reagent (<i>D. melanogaste</i>r)
                                                </td>
                                                <td>dome-Gal4</td>
                                                <td>PMID:12403714</td>
                                                <td>FLYB:FBti0022298</td>
                                                <td>FlyBase symbol: P{GawB}dome[PG14]</td>
                                            </tr>
                                            <tr>
                                                <td>genetic reagent (<i>D. melanogaster</i>)
                                                </td>
                                                <td>UAS-2xEYFP</td>
                                                <td>PMID:12324968</td>
                                                <td>FLYB:FBtp0016537</td>
                                                <td>FlyBase symbol: P{UAS-2xEYFP}</td>
                                            </tr>
                                            <tr>
                                                <td>genetic reagent (<i>D. melanogaster</i>)
                                                </td>
                                                <td>nito[HP25329]</td>
                                                <td>Bloomington Drosophila Stock Center</td>
                                                <td>BDSC:22092; FLYB:FBal0238892; RRID:
                                                    <a
                                                            href="https://scicrunch.org/resolver/BDSC_22092"
                                                    >BDSC_22092
                                                    </a>
                                                </td>
                                                <td>Genotype: w[1118]; P{w[+mC]=EPg}nito[HP25329]/CyO</td>
                                            </tr>
                                            <tr>
                                                <td>genetic reagent (<i>D. melanogaster</i>)
                                                </td>
                                                <td>nito[1]</td>
                                                <td>this paper</td>
                                                <td>&#x00A0;</td>
                                                <td>Progenitor = nito[HP25329]; imprecise excision; lethal</td>
                                            </tr>
                                            <tr>
                                                <td>genetic reagent (<i>D. melanogaster</i>)
                                                </td>
                                                <td>nito shRNA (HMJ02081)</td>
                                                <td>Bloomington Drosophila Stock Center</td>
                                                <td>TRiP:HMJ02081; BDSC:56852; RRID:
                                                    <a
                                                            href="https://scicrunch.org/resolver/BDSC_56852"
                                                    >BDSC_56852
                                                    </a>
                                                </td>
                                                <td>FlyBase symbol: P{TRiP.HMJ02081}attP40</td>
                                            </tr>
                                            <tr>
                                                <td>genetic reagent (<i>D. melanogaster</i>)
                                                </td>
                                                <td>nito dsRNA (VDRC 20942)</td>
                                                <td>Vienna Drosophila RNAi Center</td>
                                                <td>VDRC:20942</td>
                                                <td>&#x00A0;</td>
                                            </tr>
                                            <tr>
                                                <td>genetic reagent (<i>D. melanogaster</i>)
                                                </td>
                                                <td>FRT[G13]</td>
                                                <td>Bloomington Drosophila Stock Center</td>
                                                <td>BDSC:1956; FLYB:FBti0001247</td>
                                                <td>FlyBase symbol: P{FRT(whs)}G13</td>
                                            </tr>
                                            <tr>
                                                <td>genetic reagent (<i>D. melanogaster</i>)
                                                </td>
                                                <td>"y w hsflp; ubiGFP FRT[G13]"</td>
                                                <td>PMID:18160348</td>
                                                <td>&#x00A0;</td>
                                                <td>&#x00A0;</td>
                                            </tr>
                                            <tr>
                                                <td>cell line (<i>D. melanogaste</i>r)
                                                </td>
                                                <td>S2</td>
                                                <td>other</td>
                                                <td>FLYB:FBtc0000181; RRID:
                                                    <a
                                                            href="https://scicrunch.org/resolver/CVCL_Z992"
                                                    >CVCL_Z992
                                                    </a>
                                                </td>
                                                <td>Cell line maintained in N. Perrimon lab; FlyBase symbol:
                                                    S2-DRSC.
                                                </td>
                                            </tr>
                                            <tr>
                                                <td>antibody</td>
                                                <td>anti-Nito</td>
                                                <td>this paper</td>
                                                <td>&#x00A0;</td>
                                                <td>Rabbit polyclonal; against aa 479-500; used YZ3137 (1:500)</td>
                                            </tr>
                                            <tr>
                                                <td>antibody</td>
                                                <td>anti-alpha-Spectrin (mouse monoclonal)</td>
                                                <td>Developmental Studies Hybridoma Bank</td>
                                                <td>DSHB:3A9; RRID:
                                                    <a
                                                            href="https://scicrunch.org/resolver/AB_528473"
                                                    >AB_528473
                                                    </a>
                                                </td>
                                                <td>(1:10)</td>
                                            </tr>
                                            <tr>
                                                <td>antibody</td>
                                                <td>anti-Vasa (rabbit polyclonal)</td>
                                                <td>Santa Cruz Biotechnology</td>
                                                <td>Santa Cruz:sc-30210; RRID:
                                                    <a
                                                            href="https://scicrunch.org/resolver/AB_793874"
                                                    >AB_793874
                                                    </a>
                                                </td>
                                                <td>(1:250)</td>
                                            </tr>
                                            <tr>
                                                <td>antibody</td>
                                                <td>anti-Sxl (mouse monoclonal)</td>
                                                <td>Developmental Studies Hybridoma Bank</td>
                                                <td>DSHB:M18; RRID:
                                                    <a
                                                            href="https://scicrunch.org/resolver/AB_528464"
                                                    >AB_528464
                                                    </a>
                                                </td>
                                                <td>(1:10)</td>
                                            </tr>
                                            <tr>
                                                <td>antibody</td>
                                                <td>anti-GFP (rabbit polyclonal)</td>
                                                <td>Molecular Probes</td>
                                                <td>Molecular Probes:A-6455; RRID:
                                                    <a
                                                            href="https://scicrunch.org/resolver/AB_221570"
                                                    >AB_221570
                                                    </a>
                                                </td>
                                                <td>(1:1000)</td>
                                            </tr>
                                            <tr>
                                                <td>antibody</td>
                                                <td>anti-GFP (mouse monoclonal)</td>
                                                <td>Molecular Probes</td>
                                                <td>Molecular Probes:A-11120; RRID:
                                                    <a
                                                            href="https://scicrunch.org/resolver/AB_221568"
                                                    >AB_221568
                                                    </a>
                                                </td>
                                                <td>(1:200)</td>
                                            </tr>
                                            <tr>
                                                <td>antibody</td>
                                                <td>anti-HA (rat monoclonal)</td>
                                                <td>Roche</td>
                                                <td>Roche:3F10; RRID:
                                                    <a
                                                            href="https://scicrunch.org/resolver/AB_2314622"
                                                    >AB_2314622
                                                    </a>
                                                </td>
                                                <td>&#x00A0;</td>
                                            </tr>
                                            <tr>
                                                <td>antibody</td>
                                                <td>Alexa 488- or 555- secondaries</td>
                                                <td>Molecular Probes</td>
                                                <td>&#x00A0;</td>
                                                <td>(1:1000)</td>
                                            </tr>
                                            <tr>
                                                <td>other</td>
                                                <td>DAPI stain</td>
                                                <td>Molecular Probes</td>
                                                <td>&#x00A0;</td>
                                                <td>(1:1000)</td>
                                            </tr>
                                            <tr>
                                                <td>recombinant DNA reagent</td>
                                                <td>pAGW (Gateway vector)</td>
                                                <td>Drosophila Genomics Resource Center</td>
                                                <td>DGRC:1071</td>
                                                <td>&#x00A0;</td>
                                            </tr>
                                            <tr>
                                                <td>recombinant DNA reagent</td>
                                                <td>pAHW (Gateway vector)</td>
                                                <td>Drosophila Genomics Resource Center</td>
                                                <td>DGRC:1095</td>
                                                <td>&#x00A0;</td>
                                            </tr>
                                            <tr>
                                                <td>recombinant DNA reagent</td>
                                                <td>GH11110 (cDNA)</td>
                                                <td>Drosophila Genomics Resource Center</td>
                                                <td>DGRC:5666</td>
                                                <td>&#x00A0;</td>
                                            </tr>
                                            <tr>
                                                <td>recombinant DNA reagent</td>
                                                <td>GFP-Nito (plasmid)</td>
                                                <td>this paper</td>
                                                <td>&#x00A0;</td>
                                                <td>Progenitors: GH11110 (cDNA); Gateway vector pAGW</td>
                                            </tr>
                                            <tr>
                                                <td>recombinant DNA reagent</td>
                                                <td>HA-Sxl (plasmid)</td>
                                                <td>PMID:16207758</td>
                                                <td>&#x00A0;</td>
                                                <td>Progentiors: PCR, UAS-Sxl flies; Gateway vector pAHW</td>
                                            </tr>
                                            <tr>
                                                <td>recombinant DNA reagent</td>
                                                <td>GFP-Sxl (plasmid)</td>
                                                <td>PMID:16207758</td>
                                                <td>&#x00A0;</td>
                                                <td>Progentiors: PCR, UAS-Sxl flies; Gateway vector pAGW</td>
                                            </tr>
                                        </tbody>
                                    </table>
                                </asset>
                            </figure>
                            <p>eLife is tagged up as XML using the NISO standard JATS DTD. We conform to the JATS4R
                                recommendations where possible and also deliver our content to PMC. We also convert
                                our JATS XML to PubMed and CrossRef DTDs when we deposit our content with them.
                                eLife content is delivered to more repositories and it can be scraped from the eLife
                                site (<a href="#bib17">Gall et al., 2012</a>; <a href="#bib22">Horne and Page,
                                    2008</a>; <a href="#bib27">McQuilton et al., 2012</a>; <a href="#bib43">Staab
                                    et al., 2013</a>).
                            </p>
                            <p>The following is an example of monotype text within the body of an eLife article.</p>
                            <p>
                                <monospace>P<sub>NRE+AP-1</sub>: 5’– CTTCGTGACTAGTCTTGACTCAGA –3’
                                </monospace>
                            </p>
                            <p>
                                <monospace>P<sub>RAM</sub>: 5’– CTAGAAGTTTGTTCGTGACTCAGA –3’
                                </monospace>
                            </p>
                            <p>
                                <monospace>E1: 5’– CTAGAAGTTTGTTGACTCACCCGA –3’</monospace>
                            </p>
                            <p>
                                <monospace>E2: 5’– CTAGAAGTTTGTTGACTCATTAGA –3’</monospace>
                            </p>
                            <p>
                                <monospace>E3: 5’– CTAGAAGTTTGTGTATGACTCAGA –3’</monospace>
                            </p>
                            <p>
                                <monospace>CME: 5’– CTAGAAATTTGTACGTGCCACAGA –3’</monospace>
                            </p>
                            <p>In some cases, authors will include extremely long gene sequences or other letter
                                strings that need to be enclosed withing a particular style tagging in order that
                                they can be wrapped on the final HTML display. If this tagging is not included, the
                                strings will likely spill across the edge of the text column, which can look very
                                messy, not to mention rather silly:
                                <elife:sequence>
                                    TAATAAGGAAGAACTGCTTATTCTTAATTATTTCTACCTACTAAACTAACTAATTATCAACAAATATCATCTATTTAATAGTATATCATCACATGCGGTGTAAGAGGATGACATAAAGATTGAGAAACAGTCATCCAGTCTAATGGAAGCTCAAATGCAAGGGCTGATAATGTAATAGGATAATGAATGACAACGTATAAAAGGAAAGAAGATAAAGCAATATTATTTTGTAGAATTATCGATTCCCTTTTGTGGATCCCTATATCCTCGAGGAGAA
                                </elife:sequence>
                                .
                                Sequences like this should be tagged during pre-editing. This tagging will also
                                increase discoverability of gene sequences in eLife articles.
                            </p>
                        </content>
                    </section>

                </body>

            </content>
        </list-item>
    </content-list>
</root>