Skip to content

Instantly share code, notes, and snippets.

Embed
What would you like to do?
biostars.org_ 352930. "readX" could be the first read (A00223:8:H7YG3DMXX:1:1101:8892:7623)
@SQ SN:chrM LN:16571
@SQ SN:chr1 LN:249250621
@SQ SN:chr2 LN:243199373
@SQ SN:chr3 LN:198022430
@SQ SN:chr4 LN:191154276
@SQ SN:chr5 LN:180915260
@SQ SN:chr6 LN:171115067
@SQ SN:chr7 LN:159138663
@SQ SN:chr8 LN:146364022
@SQ SN:chr9 LN:141213431
@SQ SN:chr10 LN:135534747
@SQ SN:chr11 LN:135006516
@SQ SN:chr12 LN:133851895
@SQ SN:chr13 LN:115169878
@SQ SN:chr14 LN:107349540
@SQ SN:chr15 LN:102531392
@SQ SN:chr16 LN:90354753
@SQ SN:chr17 LN:81195210
@SQ SN:chr18 LN:78077248
@SQ SN:chr19 LN:59128983
@SQ SN:chr20 LN:63025520
@SQ SN:chr21 LN:48129895
@SQ SN:chr22 LN:51304566
@SQ SN:chrX LN:155270560
@SQ SN:chrY LN:59373566
@RG ID:INV_4SMALL_Aug_17_2017_1 SM:0X PL:ILLUMINA LB:libeX
@PG ID:bwa PN:bwa VN:0.7.17-r1188 CL:bwa mem -t 12 -R @RG\tID:sample1\tSM:0X\tPL:ILLUMINA\tLB:libeX -Y -a -k 11 -O 2 -B 1 -A 20 hg19_canonical_PARmaskedonchrY.fasta R1.fastq
A00223:8:H7YG3DMXX:1:1101:8892:7623 0 chr7 6776845 7 151M * 0 0 ACACAACAGAGAACAAGCCTCACAGCCCAAAGACTCCAGAACCAAGAAGGAGCCCTCTAGGACAGAAAAGGGGTATGTCGTCTTCTAGCACTTCAGATGCCATCTCTGACAAAGGCGTCCTGAGACCCCAGAAAGAGGCAGTGAGTTCCAG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF: NM:i:1 MD:Z:127T23 AS:i:2999 XS:i:2936 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1101:8892:7623 272 chr7 6026963 0 151M * 0 0 * * NM:i:4 MD:Z:23A30C17A0G77 AS:i:2936 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1101:15338:10113 16 chr7 6026731 4 151M * 0 0 CTGGTTTGAATGGCAGTCCACATCTGAAAAAGAGTCGTCAGTTTCAGGCGCTTTCTCCTGAGAGTCCACATGTTCCTGCGAGCCCCTGTCCCCTGGGGAGCTGGCCGCATACTCGCTGCTGCAGTGACTGCCCGTGTCTGGGATGCTGAAC ,FF,FFFF,FFF,FF,F,FF,:F,,:,FFF,F::FFFF:FFFFF,,::,:FFFF,F:FFFFFF:F,FF,FFFFF:FFF,FFFFFFFFFF:,FFF:F,FFFFFFFFFFFFFFFFFFFFFFF,F::F:F,F:FFFFFFFFFFFF,F,FFFFF, NM:i:1 MD:Z:44T106 AS:i:2999 XS:i:2957 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1101:15338:10113 256 chr7 6777077 0 151M * 0 0 * * NM:i:3 MD:Z:41G2T7A98 AS:i:2957 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1101:15881:12242 0 chr7 6026908 11 151M * 0 0 GTGCCCCGAGTCCTTCTCCACCTCCGCTCTGTCCGTAGGGTCACTGGGTCCGTGACTGGAACTCACTGCCTCTTTCTGAGATCTCAGGACGCCTTTGTCAGAGATGGCACCTGAAGTGCTAGAAGACAGCATACCCCTTTTCTGTCCTAGA FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,F:FFFFFFFFFFF:F,FFFFFFFFFFFFFFF:FFFFFFFFF:FF:FFF:FFFF:FFFFFFFF,FFFFFFFFF NM:i:1 MD:Z:80G70 AS:i:2999 XS:i:2895 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1101:15881:12242 272 chr7 6776900 0 151M * 0 0 * * NM:i:6 MD:Z:22T0C17A28C28G50T0 AS:i:2895 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1101:16224:15687 0 chr7 6026873 7 151M * 0 0 ATGCTGAACCCCTCAGAATCCACGGAAGTGCTGCCGTGCCCCGAGTCCTTCTCCACCTCCGCTCTGTCCGTAGGGTCACTGGGTCCGTGACTGGAACTCACTGCCTCTTTCTGAGATCTCAGGACGCCTTTGTCAGAGATGGCACCTGAAG F,FFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFF:F:FFFF:FFFFFFFFFFFFFFFF,FFFFF::FFFFFFFFFFFFFFFFFFFFFF:FFFFF,::F:F:F:FFFF:FFFFFFF:,FFF:,FFFF:FFF,F,,FF,F NM:i:1 MD:Z:115G35 AS:i:2999 XS:i:2936 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1101:16224:15687 272 chr7 6776935 0 151M * 0 0 * * NM:i:4 MD:Z:6A28C28G50T35 AS:i:2936 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1101:18810:23171 0 chr7 6791012 5 151M * 0 0 TCTCAGAACTGACCGTAGTCACTGTATGGAATAATTGGTTTTATCGCAGATTTTTATGTTTTGAAAGACAGAGTCTTCACTAACCTTTTTTGTTTTAAAATGAAACCTGCTACTTAAAAAAAATACACATCACACCCATTTAAAAGTGATC FFFFFFFFFFFFFFFFFFFF:F:FFFFFFF,FFFF,FFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 AS:i:3020 XS:i:2978 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1101:18810:23171 272 chr7 6012892 0 46M1I104M * 0 0 * * NM:i:1 MD:Z:150 AS:i:2978 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1101:18674:32894 16 chr7 6017353 5 151M * 0 0 GCAAGGAAATCAGTTTAGCCCTTTCAGTGACTGGAGCTAAAAGAATACAATTTTGAGAAAAATCCATGACTTGACAAACACGTTTCACTTGAAAGCTACTTAGGATGAACATCTGAGGCCGGGCGTGGTGGCTCACGCCTGTAATCCCTGC FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FF:FFF::FFFFFFFFFFFF::FFFFF:FF,FFFFFFFFFFFFFFFFFFFFFFF,FFFFFFF:FFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 AS:i:3020 XS:i:2978 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1101:18674:32894 256 chr7 6786552 0 151M * 0 0 * * NM:i:2 MD:Z:10T4A135 AS:i:2978 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1101:4336:33207 0 chr7 6776732 5 151M * 0 0 GGATTTGGAAAAGCCCATGGTAGAAAAGCAGGATCAATCCCCTTCATTAAGGACTGGAGAAGAAAAAAGGGACGTGTCCATTTCCAGACTGCGAGAGGCCTTTTCTCTTCGTCACACAACAGAGAACAAGCCTCACAGCCCAAAGACTCCA FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 AS:i:3020 XS:i:2978 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1101:4336:33207 272 chr7 6027076 0 151M * 0 0 * * NM:i:2 MD:Z:81T0T68 AS:i:2978 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1101:1163:35383 16 chr7 6027025 9 151M * 0 0 GCTAGAAGACAGCAGACCCCTTGTCTGTCCTAGAGGGCTCCTTCTTGGTTCTGGAGTCTTTGGGCTGTGAGGCTTGTTCTCTGTTGTGTGACGAAGAGAAAAGGCCTCTCGCAGTCTGGAAATGGACACGTCTTTTTTTTCTTCTCCAGTC FFFFFFFFFFFFFF,:FFFF,F,FFFFFFFF:FFFFFFFFF:FF::FF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFF:FF,FFFFFF NM:i:2 MD:Z:14T7T128 AS:i:2978 XS:i:2894 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1101:1163:35383 256 chr7 6776783 0 151M * 0 0 * * NM:i:6 MD:Z:17G0G109A7A2T0C10 AS:i:2894 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1102:7265:1078 16 chr7 6785874 4 151M * 0 0 CCCAGCACTCTGGGAGGCCAAGGCGGGCAGATCGCCTGAGGTCAGGAGTTTGAGACCAGCCTCGCTAACAGGGTGAAACCCCATCTCTACTGAAAATACAAAAAGTAGCCGGGCCTGGTGGCGGGTGCCTGTAATCCCAGCTACTCAGGNG F:FF,F:FF:FFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFF,F,:FFFFFF:FF:FFF:FF:FFFFFFFFF:F,FF:F::F:,:FF,FFFFF,FF,FFF::FFFFF:FFFFFFFFFFFFF:F#F NM:i:2 MD:Z:70T78A1 AS:i:2978 XS:i:2936 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1102:7265:1078 256 chr7 6018022 0 151M * 0 0 * * NM:i:4 MD:Z:1T34C43A7C62 AS:i:2936 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1102:11469:1501 0 chr7 6026961 7 151M * 0 0 GACTGGAACTCACTGCCTCTTTCTGAGATCTCAGGACGCCTTTGTCAGAGATGGCACCTGAAGTGCTAGAAGACAGCATACCCCTTTTCTGTCCTAGAGGGCTCCTTCTTGGTTCTGGAGTCTTTGGGCTGTGAGGCTTGTTCTCTGTTGT ,FF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFF:FF,FF: NM:i:1 MD:Z:27G123 AS:i:2999 XS:i:2936 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1102:11469:1501 272 chr7 6776847 0 151M * 0 0 * * NM:i:4 MD:Z:75T0C17A28C27 AS:i:2936 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1102:4029:1579 0 chr7 6777352 14 151M * 0 0 ACTCAGAACGTGTCAGCTTCTCAGGTTGATGTAGCTGTGAAAATTAATAAGAAAGTTGTGCCCCTGAACTTTTCTGAGTTCTTTAGCTAAACGAATAAAGCAGTTACATCATGAAGCACAGCAAAGTGAAGGGGAACAGAATTACAGGAAG F,FFFFFFF:FFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 AS:i:3020 XS:i:2894 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1102:4029:1579 272 chr7 6026455 0 76M2D75M * 0 0 * * NM:i:6 MD:Z:76^AT8C48G7T2C6 AS:i:2894 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1102:9679:25019 16 chr7 6785874 5 151M * 0 0 CCCAGCACTCTGGGAGGCCAAGGCGGGCAGATCGCCTGAGGTCAGGAGTTTGAGACCAGCCTCGCTAACATGGTGAAACCCCATCTCTACTGAAAATACAAAAAGTAGCCGGGCCTGGTGGCGGGTGCCTGTAATCCCAGCTACTCAGGAG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 AS:i:3020 XS:i:2978 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1102:9679:25019 256 chr7 6018022 0 151M * 0 0 * * NM:i:2 MD:Z:36C51C62 AS:i:2978 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1102:18014:27899 0 chr7 6781216 0 151M * 0 0 GTTTTTGTATTGTTTGACTTTTTTTTATTACAGTGTTCTATAACATAATCAGAAAAATAATCTTGTAAAATGTCTGATAATTAACATTTTCTACCTGCAGTAAAACGATGTTTGCAGAAATGGAAATCATTGGTCAGTTTAACCTGGGATT ,,:F:FF,FFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFF:FFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFF NM:i:0 MD:Z:151 AS:i:3020 XS:i:2998 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1102:18014:27899 272 chr7 6022572 0 125M1D26M * 0 0 * * NM:i:1 MD:Z:125^A26 AS:i:2998 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1102:8576:28025 0 chr7 6026528 29 151M * 0 0 CTCATAGAAAAGTCCAGGGGCACAACTTTCTTATTAATTTTCACAGCTACATCAACCTGAGAGGCTGACATGTCCTGAGTATTTACTAACTTTTGACAAATGTCAGAACTGGAAAGAATTTCTTCTTTTTTAAAACGCTTTGTGTTTGGGG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFF,FFFFFFFFFFFFFFF:FF:FFFFFFFF:,FFFFFFFFFF:,FF,FFFFFFFF NM:i:0 MD:Z:151 AS:i:3020 XS:i:2748 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1102:8576:28025 272 chr7 6777280 0 10M1D135M2I4M * 0 0 * * NM:i:11 MD:Z:10^A4T7G19A10C23A2G7T48A11 AS:i:2748 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1102:15600:28416 16 chr7 6777550 60 151M * 0 0 ACTAAGAAAAGAGATAAGGTAAAGTTTTAATTTTTTACTTTTTATTTTAAATTTGTATTTATTTTTATTTTTTATTTTTTTGAGACAGAATCTTGCTCTGTGCACAGGCTGGAATGCAGTGGCACAATCTTGGCTCACTGCAGCCTCCACC FF::FFFFFF:F:FFFFFFFF::F:FFFFFFF:FFFFF:FFFFFFFF,FFFFFFFFFFF:F:FFFFFFFFFFF:F::FF:F:FFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 AS:i:3020 XS:i:1835 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1102:15600:28416 272 chr11 71648298 0 12M1I37M1D2M3D8M2D40M2D17M4I1M1I2M3I23M * 0 0 * * NM:i:48 MD:Z:0T0T1C2C1C0C0T3C0T0T1C1C3G0G0C0T1G0C0A1G0G1G1A0G6A2^T2^TTA3A1C2^GA40^TT3C9G20A5G2 AS:i:1835 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1103:18584:7216 16 chr7 6026486 22 151M * 0 0 TGTGCTTCATGATGTAACTGCTTTATTCGTTTAGCTAAAGAACTCATAGAAAAGTCCAGGGGCACAACTTTCTTATTAATTTTCACAGCTACATCAACCTGAGAGGCTGACATGTCCTGAGTATTTACTAACTTTTGACAAATGTCAGAAC FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 AS:i:3020 XS:i:2813 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1103:18584:7216 256 chr7 6777323 0 103M2I46M * 0 0 * * NM:i:8 MD:Z:0A10C23A2G7T48A53 AS:i:2813 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1103:8088:8797 0 chr7 6785586 9 151M * 0 0 GAATTATGTTGTTATTCGTGTTGTTATTTTGACATGAATTCAAAATACAGTATTGTTGTTTTCATTTCATTTCTGCTGTAAAGCTAAATGTTTGACTTCAGGATATGGTTTGAATCATTTTTGTGTTTTTCAGACCTCAGACTCTCAACTT FFF:FFFFFFFFFFFFFFFFFFF::FFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFF,::FFFFFFFFF:FFFF: NM:i:0 MD:Z:151 AS:i:3020 XS:i:2936 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1103:8088:8797 272 chr7 6018310 0 151M * 0 0 * * NM:i:4 MD:Z:134A10C0T1C2 AS:i:2936 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1103:15049:13119 0 chr7 6777342 14 151M * 0 0 GTTAGTAAATACTCAGAACGTGTCAGCTTCTCAGGTTGATGTAGCTGTGAAAATTAATAAGAAAGTTGTGCCCCTGAACTTTTCTGAGTTCTTTAGCTAAACGAATAAAGCAGTTACATCATGAAGCACAGCAAAGTGAAGGGGAACAGAA FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFF:FFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:::,FFFFFFF,FFFF:FFFFF NM:i:0 MD:Z:151 AS:i:3020 XS:i:2894 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1103:15049:13119 272 chr7 6026465 0 66M2D85M * 0 0 * * NM:i:6 MD:Z:66^AT8C48G7T2C16 AS:i:2894 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1103:32551:22795 16 chr7 6785794 5 151M * 0 0 CTTCGATTTTGTTATCGATGAAAATGGTAAGTTATTAATTAGAACTATAGCGGCTGGGTGTGGTGGCTCACGTCTGTAATCCCAGCACTCTGGGAGGCCAAGGCGGGCAGATCGCCTGAGGTCAGGAGTTTGAGACCAGCCTCGCTAACAT FFFFFF:F:F,FFFFFFFF:FFFF:FFF:F:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 AS:i:3020 XS:i:2978 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1103:32551:22795 256 chr7 6018102 0 151M * 0 0 * * NM:i:2 MD:Z:8C138A3 AS:i:2978 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1103:19190:35697 0 chr7 6026928 8 151M * 0 0 CCTCCGCTCTGTCCGTAGGGTCACTGGGTCCGTGACTGGGACTCACTGCCTCTTTCTGAGATCTCAGGACGCCTTTGTCAGAGATGGCCCCTGAAGTGCTAGAAGACAGCATACCCCTGTTCTGTCCTAGAGGGCTCCTGCGTGGTTCTGG F:FFFFFFFF:FFFF:FFFFFFFFFF::FFFFFFFF,FFFFF:FFFFFFFFF:FFF,FFFF,FFFFFFFFFFF:FFFFF,FFFF,FFF,FF,F,FFF:F:FFF,FFF,FFFF:FFFFF,FFFFFF:F:FFFFFFFFFF,,F,,FFFFFFFF NM:i:6 MD:Z:39A20G27A29T20T1T9 AS:i:2894 XS:i:2810 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1103:19190:35697 272 chr7 6776880 0 151M * 0 0 * * NM:i:10 MD:Z:9A1A20A9T0C17A0T27C20T7G31 AS:i:2810 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1104:10628:11193 16 chr7 6026979 7 151M * 0 0 CTTTCTGAGATCTCAGGACGCCTTTGTCAGAGATGGCACCTGAAGTGCTAGAAGACAGCATACCCCTTTTCTGTCCTAGAGGGCTCCTTCTTGGTTCTGGAGTCTTTGGGCTGTGAGGCTTGTTCTCTGTTGTGTGACGAAGAGAAAAGGC FFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFF:FFFFF,,:FFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFF::FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:1 MD:Z:9G141 AS:i:2999 XS:i:2936 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1104:10628:11193 256 chr7 6776829 0 151M * 0 0 * * NM:i:4 MD:Z:93T0C17A28C9 AS:i:2936 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1104:10484:17769 16 chr7 6022676 7 151M * 0 0 TATGTTATAGAACACTGTAATAAAAAAAAAGTCAAACAATACAAAAACAAAATAAAGTCCCTAGCCATCCCGCTTTCTTTTTTTTTGAAACAGAGTCTCGTTCTGTCACCCAGGCTACAGTGCAATGGCACAATCTTGGCTCACTGCAACC FFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFF,FFF,F:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 AS:i:3020 XS:i:2957 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1104:10484:17769 256 chr7 6781113 0 121M1I29M * 0 0 * * NM:i:2 MD:Z:53G96 AS:i:2957 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1104:2871:24940 0 chr7 6026457 18 151M * 0 0 TCCTGTAATTCTGTTCCCCTTCACTTTGCTGTGCTTCATGATGTAACTGCTTTATTCGTTTAGCTAAAGAACTCATAGAAAAGTCCAGGGGCACAACTTTCTTATTAATTTTCACAGCTACATCAACCTGAGAGGCTGACATGTCCTGAGT FFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 AS:i:3020 XS:i:2854 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1104:2871:24940 272 chr7 6777352 0 74M2I75M * 0 0 * * NM:i:6 MD:Z:6A2G7T48A82 AS:i:2854 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1104:28754:26271 16 chr7 6777377 9 151M * 0 0 TTGATGTAGCTGTGAAAATTAATAAGAAAGTTGTGCCCCTGAACTTTTCTGAGTTCTTTAGCTAAACGAATAAAGCAGTTACATCATGAAGCACAGCAAAGTGAAGGGGAACAGAATTACAGGAAGTTTAGGGCAAGGATTTGTCCTGGAG F:FFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 AS:i:3020 XS:i:2936 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1104:28754:26271 256 chr7 6026430 0 101M2D50M * 0 0 * * NM:i:4 MD:Z:14T86^AT8C41 AS:i:2936 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1104:19633:35023 0 chr7 6776862 3 136M1D15M * 0 0 CCTCACAGCCCAAAGACTCCAGAACCAAGAAGGAGCCCTCTAGGACAGAAAAGGGGTATGTCGTCTTCTAGCACTTCAGATGCCATCTCTGACAAAGGCGTCCTGAGACCTCAGAAAGAGGCAGTGAGTTCCAGTCCTGTCTCTTATACAC FFFFFFFFF:FF:F,FFFFFFFFFFFFF:FFF,F,FFF:FFF,FFFFFF:F,F,FFFFF:F:F:FFFFFF::FFFFFFFFF:FFFFFFFFFFFFFFFFFF,FF,FFFFF:FFFFFFF:FFFFFFFFF:FFFFFFFFFFFFFFFFFFFF:FF NM:i:10 MD:Z:136^A0G0G1A1C1A0G0T0G2C1 AS:i:2809 XS:i:2767 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1104:19633:35023 272 chr7 6026945 0 15M1D136M * 0 0 * * NM:i:12 MD:Z:1G2C0A0C0T1G1T1C1^T56C17A0G60 AS:i:2767 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1104:19633:35023 256 chr13 53045167 0 26M2D9M1D10M1D8M1D2M1D13M5D11M1D6M1D3M1D9M1D3M2D3M1D2M2D11M1D13M2D22M * 0 0 * * NM:i:76 MD:Z:3G0T0A1T4G0C0T4G0G1G0G0G1^TG1G1C5^A0A0T4T1A1^C1C1G0G3^T2^A1G0T2C0A2G0A0G1^CAAGA1C4C0A1T1^C1C0T3^G0C2^G0G5G2^T1A1^AC3^G2^TC1A1A0A0G0A1A2^T1A1A0A0A1A0A2A1^AA0C17T3 AS:i:1417 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1105:27127:15092 16 chr7 6022691 7 151M * 0 0 TGTAATAAAAAAAAAGTCAAACAATACAAAAACAAAATAAAGTCCCTAGCCATCCCGCTTTCTTTTTTTTTGAAACAGAGTCTCGTTCTGTCACCCAGGCTACAGTGCAATGGCACAATCTTGGCTCACTGCAACCTCCACCTCCCGGGTT F:FFF:FFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFF:FFF:FF:FF:FFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFF:F NM:i:0 MD:Z:151 AS:i:3020 XS:i:2957 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1105:27127:15092 256 chr7 6781098 0 136M1I14M * 0 0 * * NM:i:2 MD:Z:68G81 AS:i:2957 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1105:16721:16642 0 chr7 6027090 5 151M * 0 0 TGTGAGGCTTGTTCTCTGTTGTGTGACGAAGAGAAAAGGCCTCTCGCAGTCTGGAAATGGACACGTCTTTTTTTTCTTCTCCAGTCCTTAATGAAGGGGATTGATCCTGCTTTTCTACCATGGGCTTTTCCAAATCCGCTGCATGCATTTT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 AS:i:3020 XS:i:2978 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1105:16721:16642 272 chr7 6776718 0 151M * 0 0 * * NM:i:2 MD:Z:82G0G67 AS:i:2978 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1105:19614:17237 16 chr7 6017335 0 151M * 0 0 TCCAGTTTTTACTATTTGGCAAGGAAATCAGTTTAGACATTTCAGTGACTGGAGCTAAAAGAATACAATTTTGAGAAAAATCCATGACTTGACAAACACGTTTCACTTGAAAGCTACTTAGGATGAACATCTGAGGCCGGGCGTGGTGGCT F,:,:FF,FFF,F:,FFFF:,:,:FFFF,FFFFFFF,:FF:FF::FFFFFFF:FFF,,FFFFFF:,:F:F:FFFFFF,:FFFFF::,FFFFF,,FF:,FFF:FFF::,FFFF::F,FF:FF,:FF:FF:F,FF:::F,F,F:FFFFFFFFF NM:i:3 MD:Z:14G21C1C112 AS:i:2957 XS:i:2936 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1105:19614:17237 256 chr7 6786570 0 151M * 0 0 * * NM:i:4 MD:Z:112G1G21C8G5 AS:i:2936 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1105:23158:25379 0 chr7 6776673 5 151M * 0 0 TCCCTGACCCTCTTCTCCGTCCACGTTTGCTTAGGTAACTTAATAAAAATGCATGCAGCGGATTTGGAAAAGCCCATGGTAGAAAAGCAGGATCAATCCCCTTCATTAAGGACTGGAGAAGAAAAAAGGGACGTGTCCATTTCCAGACTGC FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFF:FFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 AS:i:3020 XS:i:2978 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1105:23158:25379 272 chr7 6027135 0 151M * 0 0 * * NM:i:2 MD:Z:22T0T127 AS:i:2978 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1106:16468:4523 0 chr7 6790980 4 151M * 0 0 CCATGAGACACATCGCCAACCTGGGTGTCATTTCTCAGAACTGACCGTAGTCACTGTATGGAATAATTGGTTTTATCGCAGATTTTTATGTTTTGAGAGACAGAGTCTTCACTAACCTTTTTTGTTTTAAAATGAAACCTGCTACTTAAAA FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFF:F:FFFFFFFFFFFFFFFFF NM:i:1 MD:Z:96A54 AS:i:2999 XS:i:2957 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1106:16468:4523 272 chr7 6012924 0 14M1I136M * 0 0 * * NM:i:2 MD:Z:53T96 AS:i:2957 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1106:5113:16235 0 chr7 6027100 5 151M * 0 0 GTTCTCTGTTGTGTGACGAAGAGAAAAGGCCTCTCGCAGTCTGGAAATGGACACGTCTTTTTTTTCTTCTCCAGTCCTTAATGAAGGGGATTGATCCTGCTTTTCTACCATGGGCTTTTCCAAATCCGCTGCATGCATTTTTATTAAGTTA FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 AS:i:3020 XS:i:2978 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1106:5113:16235 272 chr7 6776708 0 151M * 0 0 * * NM:i:2 MD:Z:92G0G57 AS:i:2978 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1106:14190:25692 0 chr7 6785494 11 151M * 0 0 CACCTGGCCTGTAGCTATTTTAACTTCTAAAAAGAACTTTAAGAAAGAGAAAATTAAAAGGAACTTCTCAGGAAGTTTTGTGACACTTAGCTGAATTATGTTGTTATTCGTGTTGTTATTTTGACATGAATTCAAAATACAGTATTGTTGT FFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFF NM:i:0 MD:Z:151 AS:i:3020 XS:i:2915 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1106:14190:25692 272 chr7 6018402 0 151M * 0 0 * * NM:i:5 MD:Z:42A10C0T1C76G17 AS:i:2915 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1106:8070:27430 16 chr7 6785722 0 151M * 0 0 TCAGACTCTCAACTTAACTGCTGTTAATGAAGCTGTTCTGATAGAAAATCTGGAAATATTTAGAAAGAATGGCTTCGATTTTGTTATCGATGAAAATGGTAAGTTATTAATTAGAACTATAGCGGCTGGGTGTGGTGGCTCACGTCTGTAA FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFF:,FF,F:F:::F:FFF:FFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 AS:i:3020 XS:i:2999 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1106:8070:27430 256 chr7 6018174 0 151M * 0 0 * * NM:i:1 MD:Z:75A75 AS:i:2999 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1107:8693:6277 0 chr7 6018163 0 151M * 0 0 GAGTGCTGGGATTACAGACGTGAGCCACCACACCCAGCCGCTATAGTTCTAATTAATAACTTACCATTTTCATCGATAACAAAATCAAAGCCCTTCTTTCTAAATATTTCCAGATTTTCTATCAGAACAGCTTCATTAACAGCAGTTAAGT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFF,F,F::FF:FF,FFFF:,FFFFFFFFF,FFFFF:FFFFF,F,:FF:,,FFF,F:FF:F,:,:FFFFFF:FFFFFFFFFF,FFFFFFFFFFFFFF,FFFF:FF::F NM:i:1 MD:Z:92A58 AS:i:2999 XS:i:2978 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1107:8693:6277 272 chr7 6785733 0 151M * 0 0 * * NM:i:2 MD:Z:58T5C86 AS:i:2978 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1107:27471:21731 0 chr7 6790922 0 151M * 0 0 CTGATCACCCACATGGGGGAGATGGACCACCCCTGGAACTGTCCCCATGGAAGGCCAACCATGAGACACATCGCCAACCTGGGTGTCATTTCTCAGAACTGACCGTAGTCACTGTATGGAAGAATTGGTTTTATCGCAGATTTTTATGTTT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFF,,FFFFFFF:FFFFFFFFFFFFFFFFFFFFF NM:i:1 MD:Z:121T29 AS:i:2999 XS:i:2999 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1107:27471:21731 272 chr7 6012981 0 151M * 0 0 * * NM:i:1 MD:Z:29A121 AS:i:2999 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1107:29143:25347 0 chr7 6027080 5 151M * 0 0 GTCTTTGGGCTGTGAGGCTTGTTCTCTGTTGTGTGACGAAGAGAAAAGGCCTCTCGCAGTCTGGAAATGGACACGTCTTTTTTTTCTTCTCCAGTCCTTAATGAAGGGGATTGATCCTGCTTTTCTACCATGGGCTTTTCCAAATCCGCTG F::FFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:F,FFFFFFFF,FFFFFFFFFF:FFFFFFFFFFFF:FFFFFF:FF: NM:i:0 MD:Z:151 AS:i:3020 XS:i:2978 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1107:29143:25347 272 chr7 6776728 0 151M * 0 0 * * NM:i:2 MD:Z:72G0G77 AS:i:2978 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1107:9760:26819 16 chr7 6017348 5 151M * 0 0 AGTTGGCAAGGAAATCAGTTTAGCCCTTTCAGTGACTGGAGCTAAAAGAATACAATTTTGAGAAAAATCCATGACTTGACAAACACGTTTCACTTGAAAGCTACTTAGGATGAACATCTGAGGCCGGGCGTGGTGGCTCACGCCTGTAATC FFF::FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFF NM:i:0 MD:Z:151 AS:i:3020 XS:i:2978 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1107:9760:26819 256 chr7 6786557 0 151M * 0 0 * * NM:i:2 MD:Z:5T4A140 AS:i:2978 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1108:16731:4069 0 chr7 6776620 0 151M * 0 0 CTTTTGTGAAGTATCTGTTCACATAAGCACGTCCTCTCACCATTTCAGGATAGTCCCTGACCCTCTTCTCCGTCCACGTTTGCTTAGGTAACTTAATAAAAATGCATGCAGCGGATTTGGAAAAGCCCATGGTAGAAAAGCAGGATCAATC FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFF:FFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 AS:i:3020 XS:i:3020 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1108:16731:4069 272 chr7 6027188 0 151M * 0 0 * * NM:i:0 MD:Z:151 AS:i:3020 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1108:9968:10770 0 chr7 6786708 0 151M * 0 0 AGTAAAAGCTGGACCTTCGGACCCCAGGACGTCGATGAACTGATCTTCATGCTGAGCGACAGCCCTGGGGTCATGTGCCGGCCTTCCCGAGTCAAGCAGATGTTTGCCTCCAGAGCCTGCCGGAAGTCGGTAAGTAAAGAAAGCCTGGCTG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:F:FFFFFFFFFFF NM:i:0 MD:Z:151 AS:i:3020 XS:i:2999 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1108:9968:10770 272 chr7 6017197 0 151M * 0 0 * * NM:i:1 MD:Z:143T7 AS:i:2999 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1108:16920:33927 0 chr7 6026288 40 151M * 0 0 ATTCCAGCCTGCGCAACAGAGCAAGACTCTGTCTCAAAAAAATAAAAAATAAAAATAAAAATTTTAGATAAAAAGAGAAAAAGTAAAAAATTAAAACTTTACCTTATCTCTTTTCTTAGTTCATCTTCGGCTGCTTGATTTTCTCCAGGAC F:FFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:F:FFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 AS:i:3020 XS:i:2646 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1108:16920:33927 272 chr7 6777519 0 76M1I9M3I46M1I15M * 0 0 * * NM:i:13 MD:Z:74A4A0A2T1G1A32A13A11 AS:i:2646 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1108:13178:34773 0 chr7 6785444 10 151M * 0 0 CTGCCTGCCTCAGCCTCCTAAAGTGCTGAGATTACAGGCGTGAGCCACCGCACCTGGCCTGTAGCTATTTTAACTTCTAAAAAGAAATTTAAGAAATAGAAAATTAAAAGGAACTTATCAGGAATTTTTGTGACACTAAGCTGATTTATGT FFFFFFFFFFFF:FFFFFFFFFF:FFFFFFFFFFFFFFF:FF,F:FFFF:,F:,,,::F,FFFFF,F,,FFFF,F,:,FFFFF,:F,,,FFF,FFF,F,,FFF:,FFFF,,FF,,,,,,F,,F:,,,F:::FF:F,F,FFFF:F,,,F:,F NM:i:6 MD:Z:86C9G19C7G12T6A6 AS:i:2894 XS:i:2789 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1108:13178:34773 272 chr7 6018452 0 151M * 0 0 * * NM:i:11 MD:Z:3C0T1C6A12C7G19C9G18G53C1C11 AS:i:2789 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1108:13178:34773 272 chr9 93540383 0 5M1D5M2D16M2D3M1D9M1D4M2D33M1D6M1D4M1D2M3D5M1I58M * 0 0 * * NM:i:55 MD:Z:3G1^G0G0T1G1^GG16^CT0C2^C2C1T1T2^A1G2^AG0A0C0C0C2G0C0C0C1A0G0G2G1G1C0C1G0C0A0C2C3^C0C5^T4^C2^GAT0T1T5G14T10C9G4A1A5G5 AS:i:1839 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1108:13178:34773 256 chr15 20670400 0 64M2D6M3D1M3D3M1D4M3D6M3D4M1D9M1D9M2D10M2D2M1D5M3D2M3D7M1D19M * 0 0 * * NM:i:67 MD:Z:1C0A2C0A4G0A5C9G19T0A4C1A2C0T0C2^CA6^GTA1^AGC3^A2G1^GGC2T3^CCC2G1^G1C0C1C0C3^A3G1C1C1^CT4A2G0A1^AG2^A0A1A2^CAC2^CCA0C0A0C0A0C2^A1G15A0A0 AS:i:1616 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1108:13178:34773 272 chr15 28875457 0 17M1D4M5D7M1D2M1D4M2D11M2D8M1D7M1D7M3D6M3D4M1D2M5D2M1D5M2D65M * 0 0 * * NM:i:67 MD:Z:0T0T15^C0T3^GTGTG0T0G0G1T0G1^G2^T0T1T1^TC2T0C2T4^AG1G1G1C2^T4G0G1^G0G1C1C2^GGG3A2^GCC1C2^T2^TGCTA2^C5^GT3G0A0G2T1G4T0A19C9G5T0C4T0G2T0G1 AS:i:1616 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1108:13178:34773 256 chr15 23337804 0 64M2D6M3D1M3D3M1D4M3D6M3D4M1D9M1D9M2D10M2D2M1D5M3D2M3D7M1D19M * 0 0 * * NM:i:67 MD:Z:1C0A2C0A4G0A5C9G19T0A4C1A2C0T0C2^CA6^GTA1^AGC3^A2G1^GGC2T3^CCC2G1^G1C0C1C0C3^A3G1C1C1^CT4A2G0A1^AG2^A0A1A2^CAC2^CCA0C0A0C0A0C2^A1G15A0A0 AS:i:1616 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1108:13178:34773 256 chr1 16781093 0 39M1I19M3D9M1D4M7D9M3D8M2D14M2D4M2D5M1D8M1D4M1D3M1D6M4D1M1D17M * 0 0 * * NM:i:67 MD:Z:1C0A5T6A2C9G18T1T0G2C0A3^CAG1T1T1T0G2^C4^GAAAATC6C0C1^TGC0C0T0C1T0T2^TC1C1T0C0T0G3G1T1^GG0G0G2^GT2T2^T5A0A1^T0A0T2^G3^C6^GGAT1^A1A15 AS:i:1595 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1109:21450:8766 16 chr7 6026604 20 151M * 0 0 GAGTATTTACTAACTTTTGACAAATGTCAGAACTGGAAAGAATTTCTTCTTTTTTAAAACGCTTTGTGTTTGGGGTTGCGAGATTAGTTGGCTGAGGCAAAACTCGAAATTTACATCCGGTATCTTCCTGGTTTGAATGGCAGTCCACATC FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 AS:i:3020 XS:i:2830 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1109:21450:8766 256 chr7 6777204 0 86M1D65M * 0 0 * * NM:i:9 MD:Z:46A0G24A2T10^A4T7G19A10C21 AS:i:2830 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1109:26539:11318 16 chr7 6776701 5 151M * 0 0 GCTTAGGTAACTTAATAAAAATGCATGCAGCGGATTTGGAAAAGCCCATGGTAGAAAAGCAGGATCAATCCCCTTCATTAAGGACTGGAGAAGAAAAAAGGGACGTGTCCATTTCCAGACTGCGAGAGGCCTTTTCTCTTCGTCACACAAC FFFFFFFFFFFF:F:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 AS:i:3020 XS:i:2978 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1109:26539:11318 256 chr7 6027107 0 151M * 0 0 * * NM:i:2 MD:Z:50T0T99 AS:i:2978 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1109:18376:29403 16 chr7 6777507 32 151M * 0 0 GGGCAAGGATTTGTCCTGGAGAAAATCAAGCAGCCGAAGATGAACTAAGAAAAGAGATAAGGTAAAGTTTTAATTTTTTACTTTTTATTTTAAATTTGTATTTATTTTTATTTTTTATTTTTTTGAGACAGAATCTTGCTCTGTGCACAGG FFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFF NM:i:0 MD:Z:151 AS:i:3020 XS:i:2725 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1109:18376:29403 256 chr7 6026295 0 7M1D44M3D12M1D88M * 0 0 * * NM:i:14 MD:Z:4C2^A11C32^AAT1T0T1G2A0A3^G1G79T6 AS:i:2725 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1109:2763:33771 16 chr7 6791075 5 151M * 0 0 AAAGACAGAGTCTTCACTAACCTTTTTTGTTTTAAAATGAAACCTGCTACTTAAAAAAAATACACATCACACCCATTTAAAAGTGATCTTGAGAACCTTTTCAAACCAGATGGAGCATTGCTTGCAAATTTTTTTTCTCTATGTTTGCATG FFFF,FFFFFFFFFFFFF:F:FFFFFFF:F:FFFFFFFFF:FF:F:F::FFFFFFFFFFFFFFFF::FFF::,F:FFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FF:FFFFFFFFFFFFFF:F,FFF:FFFFF: NM:i:0 MD:Z:151 AS:i:3020 XS:i:2978 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1109:2763:33771 256 chr7 6012829 0 109M1I41M * 0 0 * * NM:i:1 MD:Z:150 AS:i:2978 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1110:13033:6621 0 chr7 6027120 4 151M * 0 0 GAGAAAAGGCCTCTCGCAGTCTGGAAATGGACACGTCTTTTTTTTCTTCTCCAGTCCTTAATGAAGGGGATTGATCCTGCTTTTCTACCATGGGCTTTTCCAAATCCGCTGCATGCATTTTTATTAAGTTACCTAAGCAAACTTGGACTGA FFF:FFF,FFFFFFFFFFF:FFFFF:,FFFFFF:FF:FFFFFFFFF:FFFF:FFFF,FFFFFFFF:,:FF:F:FFFFFFFFFFFFFF,FF:FF,F,F,F::F,FFFF::F,FFF,FFFFFFFFF::::F,F,,FFF,FFF,:,FF,F,,,F NM:i:2 MD:Z:142G5G2 AS:i:2978 XS:i:2936 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1110:13033:6621 272 chr7 6776688 0 151M * 0 0 * * NM:i:4 MD:Z:2C5C103G0G37 AS:i:2936 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1110:14163:11209 0 chr7 6777212 27 151M * 0 0 CTGCCATTCAAACCAGGAAGATACCGGATGTAAATTTCAGGTTTTGCCTCAGCCAACTAATCTCACATCCCCAAACACAAAAGTGTTTTAAGAAAGAAGAAATTCTTTCCAATTCTGACATTCGTCAAAAGTTAGTAAATACTCAGAACGT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 AS:i:3020 XS:i:2768 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1110:14163:11209 272 chr7 6026597 0 69M1I81M * 0 0 * * NM:i:11 MD:Z:1T2C23A10C19T7G14T2C24T0C38 AS:i:2768 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1110:18864:11772 16 chr7 6785943 0 151M * 0 0 ATGGTGAAACCCCATCTCTACTGAAAATACAAACAGTAGCCGGGCCTGGTGGCGGGTGCCTGTAATCCCAGCTACTCAGGAGGCTGAGGTGGGAGAATCGCTTGAACCCGGGAGGTGGAGGTTGCAGTGAGCCGAGATCACGTCACTGCAC ,,FF,FFFFFF:F,FF:F:FFFFFFFF::FF:F,F:,F:FFFF:FFF:F:FFFFFFFFFFFFFF,,FFF:FFFFFFFFFF::FF:FFFFFFFFFF::FFFFF:F,FFFFFFFFFFFFFFFF,,FFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:1 MD:Z:33A117 AS:i:2999 XS:i:2978 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1110:18864:11772 256 chr7 6017953 0 151M * 0 0 * * NM:i:2 MD:Z:105C11T33 AS:i:2978 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1110:18864:11772 272 chr15 27720092 0 151M * 0 0 * * NM:i:14 MD:Z:35T4T4A7A2C0A31C0A17T2A20T6G2C2G5 AS:i:2726 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1110:18864:11772 272 chr9 6652295 0 151M * 0 0 * * NM:i:15 MD:Z:35T9A7A2C32C0A7T0A9A18C4A4T0G0A1A8 AS:i:2705 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1110:18864:11772 272 chr19 454603 0 34M3D117M * 0 0 * * NM:i:17 MD:Z:1G32^AAA1T4T1A2A10C7G24C0A24C9G13G2C3G4 AS:i:2664 RG:Z:INV_4SMALL_Aug_17_2017_1
A00223:8:H7YG3DMXX:1:1110:18864:11772 272 chr14 74046095 0 151M * 0 0 * * NM:i:18 MD:Z:35T6A2G5C0T3C20G8T2C0A8A6A4A12T0G13G0T1C8 AS:i:2642 RG:Z:INV_4SMALL_Aug_17_2017_1
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment