Aizazahmed-7
rh-operator-bundle-bot
/ operator-hosted-pipeline-runrdl5z.log
Created
May 8, 2024 07:15
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Pipeline still running ... | |
| PipelineRun is still running: Tasks Completed: 37 (Failed: 1, Cancelled 0), Incomplete: 3, Skipped: 11 | |
| [get-pr-number : parse-pr-url] + echo -n 335 | |
| [get-pr-number : parse-pr-url] + tee /tekton/results/git_pr_number | |
| [get-pr-number : parse-pr-url] 335 | |
| [acquire-lease : create-lease] + calculate_duration_in_seconds 90m | |
| [acquire-lease : create-lease] + '[' m == m ']' | |
| [acquire-lease : create-lease] + TOTAL_DURATION_IN_SECONDS=5400 | |
| [acquire-lease : create-lease] + export TOTAL_DURATION_IN_SECONDS |
GrahamcOfBorg
/ Potential Maintainers
Created
May 7, 2024 11:19
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Maintainers: | |
| opna2608: furnace, furnace, furnace, furnace |
rench
/ XORCipher.js
Created
May 7, 2024 11:16
— forked from sukima/XORCipher.js
A Super simple encryption cipher using XOR and Base64 in JavaScript
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| // XORCipher - Super simple encryption using XOR and Base64 | |
| // | |
| // Depends on [Underscore](http://underscorejs.org/). | |
| // | |
| // As a warning, this is **not** a secure encryption algorythm. It uses a very | |
| // simplistic keystore and will be easy to crack. | |
| // | |
| // The Base64 algorythm is a modification of the one used in phpjs.org | |
| // * http://phpjs.org/functions/base64_encode/ | |
| // * http://phpjs.org/functions/base64_decode/ |
baobabprince
/ DB27.226_microbiome_data.csv
Created
May 7, 2024 11:05
Microbiome data for sample: DB27.226 . ASV column represent the sequence of specific bacteria. than there is the Taxonomic levels names. and the prevelance of specific bacteria in your gut and in the healthy population in israel. For further information about each bacteria, the last column contains a link to dbBact, showing information where the…
We can make this file beautiful and searchable if this error is corrected: Unclosed quoted field in line 3.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| "Kingdom","Phyla","Class","Order","Family","Genus","Species","You","Population","ASV","link" | |
| "k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Prevotellaceae"," g__Prevotella"," s__copri",0.317892358258011,0.123966304244692,"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG","http://dbbact.org/search_results?sequence=TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG" | |
| "k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__S24-7"," g__"," s__",0.110209531635168,0.0315770158898006,"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCTGCGAGGCAAGTCAGCGGTCAAATGTCGGGGCTCAACCCCGGCCTGCCGTTGAAACTGTCCTGCTAGAGTTCGAGTGAGGTATGCGGAATGCGTTGT","http://dbbact.org/search_results?sequence=TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCTGCGAGGCAAGTCAGCGGTCAAATGTCGGGGCTCAACCCCG |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| SELECT * | |
| FROM ( | |
| SELECT | |
| o.distributor_id, | |
| ui.firstname || ' ' ||ui.lastname distributor_name, | |
| ui.phone, | |
| ui.email, | |
| to_char(o.state_date, 'YYYY-MM') qualified_date, | |
| sum(o.pvq) pvq_total | |
| FROM user_infos ui |
Untrusted-Game
/ untrusted-lvl2-solution.js
Created
May 6, 2024 08:56
Solution to level 2 in Untrusted: http://alex.nisnevich.com/untrusted/
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| /******************** | |
| * theLongWayOut.js * | |
| ******************** | |
| * | |
| * Well, it looks like they're on to us. The path isn't as | |
| * clear as I thought it'd be. But no matter - four clever | |
| * characters should be enough to erase all their tricks. | |
| */ | |
| function startLevel(map) { |
HugsLibRecordKeeper
/ output_log.txt
Created
May 4, 2024 17:23
Rimworld output log published using HugsLib
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Log uploaded on Saturday, May 4, 2024, 7:23:09 PM | |
| Loaded mods: | |
| Harmony(brrainz.harmony)[mv:2.3.1.0]: 0Harmony(2.3.3), HarmonyMod(2.3.1) | |
| Core(Ludeon.RimWorld): (no assemblies) | |
| Royalty(Ludeon.RimWorld.Royalty): (no assemblies) | |
| Ideology(Ludeon.RimWorld.Ideology): (no assemblies) | |
| Biotech(Ludeon.RimWorld.Biotech): (no assemblies) | |
| Anomaly(Ludeon.RimWorld.Anomaly): (no assemblies) | |
| Vanilla Expanded Framework(OskarPotocki.VanillaFactionsExpanded.Core): 0ModSettingsFramework(1.0.0), 0MultiplayerAPI(av:0.3.0,fv:0.3.0), 0PrepatcherAPI(1.1.1), ExplosiveTrailsEffect(1.0.7140.31563), GraphicCustomization(1.0.0), HeavyWeapons(1.0.0), KCSG(av:1.1.2,fv:24.4.15), MVCF(2.0.0.1), NoCamShakeExplosions(1.0.0), OPToxic(1.0.0), Outposts(av:3.0.0,fv:1.0.0), PipeSystem(av:1.0.1,fv:22.7.29), RecipeInheritance(1.0.1), RRO(1.0.0), SmokingGun(1.0.0), VanillaStorytellersExpanded(1.0.0), VanillaWeaponsExpandedLaser(0.0.0), VFECore(av:1.1.7,fv:1.1.9), VWEMakeshift(1.0.0) | |
| Vanilla Fishing Expanded(VanillaExpanded.VCEF): VCE-Fishing(1.0.0) |