This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
""" | |
Find start/stop coordinates given a Stockholm file with INSDC accessions. | |
Before: | |
AE015928_959 GUGUUUUUCAUAGUA | |
AP006841_261 GUGUUUUUCAUAGUA | |
CP000139_346 GUGUUUUUCAUAGUA | |
After: | |
AE015928.1/959075-959219 GUGUUUUUCAUAGUA |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
""" | |
A quick and dirty script to generate outlines from R-scape SVG diagrams. | |
- Based on https://github.com/RNAcentral/auto-traveler | |
- Requires R-scape (http://eddylab.org/R-scape) | |
Usage: | |
1. Run R-scape on your Stockholm file of interest: |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
{ | |
"hitCount": 3, | |
"entries": [ | |
{ | |
"id": "URS0000759B6D_9606", | |
"source": "rnacentral", | |
"fields": { | |
"description": [ | |
"Homo sapiens (human) microRNA hsa-mir-126 precursor" | |
], |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
""" | |
Copyright [2009-present] EMBL-European Bioinformatics Institute | |
Licensed under the Apache License, Version 2.0 (the "License"); | |
you may not use this file except in compliance with the License. | |
You may obtain a copy of the License at | |
http://www.apache.org/licenses/LICENSE-2.0 | |
Unless required by applicable law or agreed to in writing, software | |
distributed under the License is distributed on an "AS IS" BASIS, | |
WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. | |
See the License for the specific language governing permissions and |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
1 G 2876 | |
2 G 2875 | |
3 U 2874 | |
4 C 2873 | |
5 A 2872 | |
6 A 2871 | |
7 G 2870 | |
8 A 2869 | |
15 G 535 | |
16 G 534 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
>GenomeXXX | |
CCAGAACGACAACCGAACACCGCAGCCGAAGACGTCGTGCGGGAGAGTCCTCACCAGCGG | |
ATGAGGCGCCGAAGGAGCAATACTCCCCGCCAAACTCTCAGGCCCAGTCACCGCACGGCA | |
CCAGGCTGAACACGGAGAAAAGCAGGGGCGCGCGAGCGCCTCTCGCCCAAGGTGCAAGCC | |
GCGCGTTCCGGCGTGGTGAAACTCTCAGGCCAATGACTCCGGGGAGACCGCCGACCAGCG | |
CATGCCCGCGCGGGTCGCAGTCGAGCTGGCCCGGATAAGGTAAGGCCGAAGTGAGCGGCC | |
CGGCTCTGGACTGCCGACCGGCGCCCCCACCAGGAGGAGTTCCGCACCATGTCGTCGCCC | |
CGGCAGACACCCCTGCACGAGATCCACGAAGCGCTCGGCGCCACCTTCACCGAGTTCGCC | |
GGCTGGCGGATGCCGCTGCGCTACACGGGCGACGCGGCCGAGCACAACGCGGTGCGCACC | |
GCCGCGGGCCTGTTCGACTTGACCCACATGGGTGAAATCCGCATCAGCGGCCCGCAGGCG |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
table rnacentralBed | |
"BED12+2 RNAcentral Bed" | |
( | |
string chrom; "Reference sequence chromosome" | |
uint chromStart; "Start position of the first DNA base" | |
uint chromEnd; "End position of the last DNA base" | |
string name; "RNAcentral identifier" | |
uint score; "Always ." | |
char[1] strand; "+ or - for strand" | |
uint thickStart; "Coding region start" |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
# Base image https://hub.docker.com/_/perl/ | |
FROM perl:latest | |
# install cpanm | |
RUN curl -L http://cpanmin.us | perl - App::cpanminus | |
# install dependencies | |
RUN cpanm Cache::Memcached | |
RUN cpanm Catalyst::Action::RenderView | |
RUN cpanm Catalyst::Controller::REST |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
CREATE TABLE backup_rnc_reference_map AS SELECT * FROM rnc_reference_map; | |
-- choose max reference id out of all references with same pmid | |
CREATE TEMP TABLE rnc_reference_map_max_id AS | |
select max(id) as max_id, pmid | |
from rnc_references | |
where | |
pmid is not null | |
and pmid != '' | |
group by pmid |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
import requests | |
EXPERT_DATABASES = [ | |
'expert_db:"dictybase"', | |
'expert_db:"ena"', | |
'expert_db:"ensembl"', | |
'expert_db:"flybase"', | |
'expert_db:"gencode"', | |
'expert_db:"greengenes"', | |
'expert_db:"gtrnadb"', |
NewerOlder