Skip to content

Instantly share code, notes, and snippets.

@cinquin
Created February 6, 2025 19:14
Show Gist options
  • Save cinquin/d164ceaa3e17106c5500db008cdb5b3f to your computer and use it in GitHub Desktop.
Save cinquin/d164ceaa3e17106c5500db008cdb5b3f to your computer and use it in GitHub Desktop.
Reverse-complemented sequence
TCGATCTCTAGATCCTCTCGATATCGTTTTATCGCACGCTTCGATCTCTAGATCGCTACGCACGCTTCGATCTCTAGATCCTCTCGATATCGCTTTTTCGCTACGCACGCT
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment