Created
February 6, 2025 19:14
-
-
Save cinquin/d164ceaa3e17106c5500db008cdb5b3f to your computer and use it in GitHub Desktop.
Reverse-complemented sequence
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
TCGATCTCTAGATCCTCTCGATATCGTTTTATCGCACGCTTCGATCTCTAGATCGCTACGCACGCTTCGATCTCTAGATCCTCTCGATATCGCTTTTTCGCTACGCACGCT |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment