Skip to content

Instantly share code, notes, and snippets.

@RennZz-Dev
RennZz-Dev / ytplay.js
Created September 7, 2026 09:56
Uploaded via LynnaBot - 2026-09-07T09:56:07.162Z
import { searchYoutube, getYoutubeDirectUrl } from '../../lib/scraper/youtube.js';
import { AIRich } from '../../lib/ui/MessageBuilder.js';
import axios from 'axios';
function escapeHtmlJs(value) {
return String(value ?? '')
.replace(/\\/g, '\\\\')
.replace(/"/g, '\\"')
.replace(/`/g, '\\`')
.replace(/\$\{/g, '\\${')
@baobabprince
baobabprince / DB39.139_microbiome_data.csv
Created September 7, 2026 09:55
Microbiome data for sample: DB39.139 . ASV column represent the sequence of specific bacteria. than there is the Taxonomic levels names. and the prevelance of specific bacteria in your gut and in the healthy population in israel. For further information about each bacteria, the last column contains a link to dbBact, showing information where the…
We can make this file beautiful and searchable if this error is corrected: Unclosed quoted field in line 3.
"Kingdom","Phyla","Class","Order","Family","Genus","Species","You","Population","ASV","link"
"k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Prevotellaceae"," g__Prevotella"," s__copri",0.285343114779153,0.131895739026914,"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG","http://dbbact.org/search_results?sequence=TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG"
"k__Bacteria"," p__Firmicutes"," c__Clostridia"," o__Clostridiales"," f__Veillonellaceae"," g__Dialister"," s__",0.128381476386978,0.0369167497635229,"TACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCTTCTTAAGTCCATCTTAAAAGTGCGGGGCTTAACCCCGTGATGGGATGGAAACTGAGAGGCTGGAGTATCGGAGAGGAAAGTGGAATTCCTAGT","http://dbbact.org/search_results?sequence=TACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCTTCTTAAGTCCATCTTAAAAGTG
@TaahaACI
TaahaACI / prom_metrics.py
Created September 7, 2026 09:55
Prometheus fastapi code snippet
import os
from fastapi import FastAPI, HTTPException, Security, status
from fastapi.security.api_key import APIKeyHeader
from prometheus_fastapi_instrumentator import Instrumentator, metrics
METRICS_SECRET_TOKEN = os.getenv("METRICS_SECRET_TOKEN", "your_secret_token_here") # Replace with your actual secret token
api_key_header = APIKeyHeader(name="X-Metrics-Token", auto_error=False)
async def verify_metrics_token(token: str = Security(api_key_header)):
if not token or token != METRICS_SECRET_TOKEN:
print(f"Unauthorized access attempt to /metrics endpoint with token: {token}")
@csh1668
csh1668 / metadata.json
Created September 7, 2026 09:54
RimWorld AutoTranslation Cache - Russian / Русский (Google)
{"targetLanguage":"Russian \/ Русский","translatorName":"Google","translatorModel":"Google","date":"2026-09-07 12:54:41","translationCount":0}

Privacy Policy for Efficient Me

Last Updated: August 27, 2026

Efficient Me ("we", "our", or "the app") is built from the ground up with a Zero-Cloud, 100% Local-First Data Sovereignty philosophy. We believe your productivity, personal habits, energy scores, and daily tasks are private to you and should never leave your physical device.


1. Information We Collect

None. Efficient Me does not collect, transmit, store, or sell any personal information, behavioral analytics, location data, or device identifiers to external servers or third parties.

<!DOCTYPE html>
<html>
<!DOCTYPE html>
<html lang="ko">
<head>
<meta charset="UTF-8">
<meta name="viewport" content="width=device-width, initial-scale=1.0">
<title>역설법 vs 반어법 스피드 퀴즈!</title>
<style>
* {
@HugsLibRecordKeeper
HugsLibRecordKeeper / output_log.txt
Created September 7, 2026 09:53
Rimworld output log published using HugsLib
Log uploaded on Monday, September 7, 2026, 5:53:31 PM
Loaded mods:
Prepatcher(zetrith.prepatcher): 0Harmony(2.4.2), 0PrepatcherAPI(1.2.0), 0PrepatcherDataAssembly(1.0.0), PrepatcherImpl(1.0.0), Prestarter(1.0.0)
Harmony(brrainz.harmony)[mv:2.4.2.0]: 0Harmony(av:2.4.2,fv:2.4.1), HarmonyMod(2.4.2)
Core(Ludeon.RimWorld): (no assemblies)
Royalty(Ludeon.RimWorld.Royalty): (no assemblies)
Ideology(Ludeon.RimWorld.Ideology): (no assemblies)
Biotech(Ludeon.RimWorld.Biotech): (no assemblies)
Anomaly(Ludeon.RimWorld.Anomaly): (no assemblies)
Odyssey(Ludeon.RimWorld.Odyssey): (no assemblies)
<!DOCTYPE html>
<html>
<!DOCTYPE html>
<html lang="ko">
<head>
<meta charset="UTF-8">
<meta name="viewport" content="width=device-width, initial-scale=1.0">
<title>역설법 vs 반어법 스피드 퀴즈!</title>
<style>
* {
@dev-vitaliy
dev-vitaliy / visual-monitoryml-github-actions-visual-regression-workflow.md
Created September 7, 2026 09:53
visual-monitor.yml — GitHub Actions visual regression workflow

visual-monitor.yml

GitHub Actions workflow: visual regression check on every PR

Captures screenshots of key pages and compares against main branch baseline.

Setup:

  1. Add BASELINE_SITE_URL and STAGING_SITE_URL to repository secrets
@v4dkou
v4dkou / README.md
Created September 7, 2026 09:53
Playwright walkthrough for newly-app/newly#4956

Playwright walkthrough for newly-app/newly#4956 at 4c971e9785c645ca5f29002bd33bf84231fa882a.