Built with blockbuilder.org
This simple bar chart is constructed from a TSV file storing the frequency of letters in the English language. The chart employs conventional margins and a number of D3 features:
- d3.tsv - load and parse data
- d3.format - format percentages
- d3.scale.ordinal - x-position encoding
- d3.scale.linear - y-position encoding
- d3.max - compute domains
- d3.svg.axis - display axes
This simple bar chart is constructed from a TSV file storing the frequency of letters in the English language. The chart employs conventional margins and a number of D3 features:
- d3.tsv - load and parse data
- d3.format - format percentages
- d3.scale.ordinal - x-position encoding
- d3.scale.linear - y-position encoding
- d3.max - compute domains
- d3.svg.axis - display axes
Built with blockbuilder.org
Built with blockbuilder.org
Genome browser for phamerator.org
forked from scresawn's block: genome browser
Built with blockbuilder.org
Built with blockbuilder.org
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
//Stores sequence in an array of codons | |
var sequence = "GCAAACCTGCGCGGCGATGATGCTGAGCGCGCATGTAGCTAGTCGCGGCGTAGCTAGCC" | |
var aminoArray = []; | |
var startNuc = 0; | |
for(i=1;i<sequence.length/3;i++){ | |
aminoArray.push(sequence.substring(startNuc,startNuc+3)); | |
startNuc = i*3; | |
} | |
//Matches sequence to amino acid |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
var sequence = "GCAAACCTGCGCGGCGATGATGCTGAGCGCGCATGTAGCTAGTCGCGGCGTAGCTAGCC"; | |
var reverse = ""; | |
for(i=0;i<sequence.length;i++){ | |
switch(sequence[i]){ | |
case "A": | |
reverse = reverse + "T" | |
break; | |
case "G": | |
reverse = reverse + "C" | |
break; |
OlderNewer