Without modifying the information in genes.json, use D3 to construct a pie chart that shows the relative fraction of genes in the forward and reverse directions. Your code must dynamically generate the pie chart from the data. In other words, if I modify the genes.json data file, the pie chart must update automatically. (15 points)
forked from scresawn's block: final exam question 2
forked from anonymous's block: final exam question 2
Using D3, draw the flag of the Red Cross. As an example, look at the first flag here:
http://www.crwflags.com/fotw/flags/int-red.html#cross
Use an aspect ratio of 1:1, with a width and height of 400 pixels. The width of the cross should be 80% of the width of the flag. (15 points)
forked from scresawn's block: final exam question 1
forked from anonymous's block: final exam question 1
Genome browser for phamerator.org
forked from scresawn's block: genome browser
forked from mcgovemc's block: Final Genome Browser
| //The two sequences to compare | |
| var sequence1 = "ATGCGAATCGC" | |
| var sequence2 = "ATCCTACCG" | |
| //Creates multi-dimensional array dependent on sequence lengths | |
| var arr = new Array(sequence2.length + 1) | |
| for (i = 0; i < sequence2.length + 1; i++) { | |
| arr[i] = new Array(sequence1.length + 1); | |
| } |
Built with blockbuilder.org
Genome browser for phamerator.org
forked from scresawn's block: genome browser
forked from mcgovemc's block: genome browser with tool tip
Built with blockbuilder.org
Built with blockbuilder.org
Built with blockbuilder.org
| var sequence = "ATGCTGATCGCGCGATCGTAGCTAGTTCGATCGATGTGACGTACTGACTGACGTTGGATCTGATGCTATTTATCGAGCGCTAGCATCGCGATCGCGCATGCGCCATACG"; | |
| var gCount=0; | |
| var cCount=0; | |
| var aCount=0; | |
| var tCount=0; | |
| for(i=0;i<sequence.length;i++){ | |
| switch(sequence[i]){ | |
| case "A": | |
| aCount++ | |
| break; |