Bede Constantinides bede
bede
/ gist:ce9b2992bfc1bcb763a0
Last active
August 29, 2015 14:07
homebrew-science: AMOS install aborts due to 'unsatisfied' Perl dependency
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| bede-rmbp:~ bede$ brew update && brew upgrade && brew doctor | |
| Already up-to-date. | |
| Please note that these warnings are just used to help the Homebrew maintainers | |
| with debugging if you file an issue. If everything you use Homebrew for is | |
| working fine: please don't worry and just ignore them. Thanks! | |
| Warning: "config" scripts exist outside your system or Homebrew directories. | |
| `./configure` scripts often look for *-config scripts to determine if | |
| software packages are installed, and what additional flags to use when | |
| compiling and linking. |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| <?php | |
| // Send basic email alerts from cURL etc. | |
| // Usage: curl domain.com/email_alert.php?script-ran-successfully | |
| mail('mail@domain.com', 'Alert: ' . $_SERVER['QUERY_STRING'], 'Request origin: ' . $_SERVER['SERVER_ADDR']); | |
| ?> |
bede
/ gist:fb19d960783aaa888d34
Created
March 6, 2015 13:18
Zurb Foundation CLI: `new <project> --libsass` throws fatal error
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| bede-rmbp:www bede$ foundation new project --libsass | |
| Creating ./project | |
| create project | |
| Cloning into 'project'... | |
| remote: Counting objects: 173, done. | |
| remote: Total 173 (delta 0), reused 0 (delta 0), pack-reused 173 | |
| Receiving objects: 100% (173/173), 235.17 KiB | 436.00 KiB/s, done. | |
| Resolving deltas: 100% (63/63), done. | |
| Checking connectivity... done. | |
| Installing dependencies with bower... |
bede
/ google-latest-jquery
Created
December 18, 2011 14:49
Load newest JQuery 1.x library from Google's CDN
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| <script src="http://ajax.googleapis.com/ajax/libs/jquery/1/jquery.min.js" type="text/javascript"></script> |
bede
/ gist:e12abda8064d64003639
Created
October 7, 2015 11:02
SPAdes 3.6.1 Homebrew-science build error
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Bede$ brew install spades | |
| ==> Installing spades from homebrew/homebrew-science | |
| ==> Downloading https://homebrew.bintray.com/bottles-science/spades-3.6.1.yosemite.bottle.tar.gz | |
| curl: (22) The requested URL returned error: 404 Not Found | |
| Error: Failed to download resource "spades" | |
| Download failed: https://homebrew.bintray.com/bottles-science/spades-3.6.1.yosemite.bottle.tar.gz | |
| Warning: Bottle installation failed: building from source. | |
| ==> Downloading http://spades.bioinf.spbau.ru/release3.6.0/SPAdes-3.6.1.tar.gz | |
| Already downloaded: /Library/Caches/Homebrew/spades-3.6.1.tar.gz |
bede
/ gist:888cb52404682a28adc2
Created
October 7, 2015 11:03
SPAdes 3.6.1 proposed homebrew formula
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| class Spades < Formula | |
| desc "SPAdes: de novo genome assembly" | |
| homepage "http://bioinf.spbau.ru/spades/" | |
| bottle do | |
| cellar :any | |
| sha256 "9d69a98a442701f818df56325beeb1ddc8457da5932da172706becf18f6d3fed" => :yosemite | |
| sha256 "89ff010f4542bb2f63144c642a125fdedee8367a14410bfd3b30c6b27caeb1c9" => :mavericks | |
| sha256 "834d20f5a8b812cdb8c1e2b9c36a8baf35b5f6e5d7f3af910350713a3357ae5e" => :mountain_lion | |
| end |
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| >EDGE_1_length_179_cov_1.64557; | |
| TAGCATTTTAATATTATACATAACATGGTATAATATTAGATGTGTAATATAAAATCTAAA | |
| GCAACTACTACAAAAACAATACTAGAAGTTATGGCTACTAAGCCAACAAAGGATAAAAAA | |
| TAGAATCAAAATTAATTAATCCAAAAGAAGGAAGTAAAAGGGAACAAAGAATAGGTGGG | |
| >EDGE_1_length_179_cov_1.64557'; | |
| CCCACCTATTCTTTGTTCCCTTTTACTTCCTTCTTTTGGATTAATTAATTTTGATTCTAT | |
| TTTTTATCCTTTGTTGGCTTAGTAGCCATAACTTCTAGTATTGTTTTTGTAGTAGTTGCT | |
| TTAGATTTTATATTACACATCTAATATTATACCATGTTATGTATAATATTAAAATGCTA | |
| >EDGE_2_length_255_cov_1.11111; | |
| GAAAAACTCATTCTATGAGTGAATACACTTGGCAAGAAGTAGTGGGGCTGTAATTGTGAT |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| var tracks = [ | |
| { | |
| trackName: "track1", | |
| trackType: "track", | |
| visible: true, | |
| trackFeatures: "complex", | |
| featureThreshold: 1000, | |
| mouseover_callback: 'islandPopup', | |
| mouseout_callback: 'islandPopupClear', | |
| linear_mouseclick: 'linearPopup', |
bede
/ ebi_parallel_blast.ipynb
Last active
November 2, 2015 12:42
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
OlderNewer