Skip to content

Instantly share code, notes, and snippets.

View bsipos's full-sized avatar

Botond Sipos bsipos

95 followers · 324 following
View GitHub Profile
@bsipos
bsipos / self_document.snake
Created November 3, 2016 09:51
# This snippet add the "self-documenting" feature to snakemake files.
# It is inspired by the Makefile in https://github.com/audreyr/cookiecutter-pypackage
# Add the follwing to your snakefile or include: "self_document.snake"
import re
def generate_help(sfile):
"""Parse out target and help message from file."""
handler = open(sfile, "r")
for line in handler:
@bsipos
bsipos / samsana
Last active October 5, 2017 14:30
A SAM sanitiser in go.
package main
import (
"fmt"
"github.com/biogo/hts/sam"
"io"
"os"
)
func main() {
@bsipos
bsipos / read_fastq.go
Last active October 21, 2017 17:50
package main
// Import the standard formatting library:
import "fmt"
// Import the os library - needed for opening files:
import "os"
// Import the io library - needed for checking for EOF:
import "io"
@bsipos
bsipos / read_fastq_seq.go
Created October 21, 2017 16:07
package main
import (
"fmt"
"github.com/biogo/biogo/alphabet"
"github.com/biogo/biogo/io/seqio/fastq"
"github.com/biogo/biogo/seq/linear"
"io"
"os"
)
@bsipos
bsipos / fastq_to_fasta.go
Created October 21, 2017 16:40
package main
// Import libraries:
import (
"github.com/biogo/biogo/alphabet"
"github.com/biogo/biogo/io/seqio/fasta"
"github.com/biogo/biogo/io/seqio/fastq"
"github.com/biogo/biogo/seq/linear"
"io"
"os"
@bsipos
bsipos / mean_qual.go
Last active October 21, 2017 17:51
package main
// Import the standard formatting library:
import "fmt"
// Import the os library - needed for opening files:
import "os"
// Import the io library - needed for checking for EOF:
import "io"
@bsipos
bsipos / read_bam.go
Created October 21, 2017 19:02
package main
//Import the required libraries:
import (
"fmt"
"github.com/biogo/hts/bam"
"github.com/biogo/hts/sam"
"io"
"os"
)
@bsipos
bsipos / read_bed.go
Created October 21, 2017 19:26
package main
//Import the necessary libraries:
import (
"fmt"
"github.com/biogo/biogo/io/featio/bed"
"io"
"os"
)
@bsipos
bsipos / fragtool.go
Created October 21, 2017 19:55
package main
//Import the required libraries:
import (
"fmt"
"github.com/biogo/biogo/feat"
"github.com/biogo/biogo/io/featio/bed"
"github.com/biogo/hts/bam"
"github.com/biogo/hts/sam"
"io"
@bsipos
bsipos / alignments.sam
Last active December 2, 2021 16:33
racon error input data
@SQ SN:156f2c40-af12-4246-b33e-5173efb619ae LN:3440
@PG ID:minimap2 PN:minimap2 VN:2.5-r574-dirty CL:minimap2 -ax map-ont -k14 /home/OXFORDNANOLABS/bsipos/gt/pinfish/polish_clusters/pinfish_156f2c40-af12-4246-b33e-5173efb619ae_492532246/reference.fq /home/OXFORDNANOLABS/bsipos/gt/pinfish/polish_clusters/pinfish_156f2c40-af12-4246-b33e-5173efb619ae_492532246/reads.fq
8685e210-7cfa-40f1-b2b8-4bc5b6a89c26 0 156f2c40-af12-4246-b33e-5173efb619ae 2911 52 120S9M1I1M2D15M1D6M3D21M8D21M2I5M2I9M1I16M1D2M1I4M1D20M1I3M3D11M2D3M1D33M1D9M1I11M1D4M2D13M3D2M2D6M3I38M2I33M2D5M3D3M1D1M2D1M1D1M1D9M1D9M2I10M2D1M1D1M2D10M1I12M1I1M2I12M2I6M1D4M2I14M1I11M42S * 0 0 GATTAAGCGCAGTGTGGCACGTCATCGAGGAAGACAAATAACATTGGAAGAAAATCCTATCATCTTAACACCATCATCCATCCCAACCTACATCCTCAAAAAAAAGATTGTAGGCCGCGAATTACCCGCATGGCAATGGGTAGTTCTGCCGCGTGAACAAACCGCCATGAGTGCGGTCGGCGACCGGAGACAGCTGGCGACCAACGGCCTGGCCGAAGGCCTTAAGGCTACTCATCAGCCGACCGATCCATCAAGTGCACGGTCGTAACTTTGCGCAATAGTTGCGGCGCTATCTCCATCGCTGAGTCAAACGTATGGTCGTGGTGTTGTGCAAATCCCCATTCGGGACGCGAAGGTAAAGGTTTAACATGTTT