Here is an essay version of my class notes from Class 1 of CS183: Startup. Errors and omissions are my own. Credit for good stuff is Peter’s entirely.
CS183: Startup—Notes Essay—The Challenge of the Future
Purpose and Preamble
Carl Crott carlcrott
carlcrott
/ peter-thiels-cs183-startup-class-01-notes-essay.md
Created
February 10, 2014 15:52
— forked from jbenet/peter-thiels-cs183-startup-class-01-notes-essay.md
carlcrott
/ output error
Last active
August 29, 2015 13:59
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| test.hs:1:1: Parse error: naked expression at top level |
carlcrott
/ gist:10936495
Last active
August 29, 2015 13:59
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| $ sudo apt-get install nodejs | |
| $ sudo npm install -g phonegap | |
| $ sudo npm install -g appium | |
| $ appium | |
| error: Appium will not work if used or installed with sudo. Please rerun/install as a non-root user. If you had to install Appium using `sudo npm install -g appium`, the solution is to reinstall Node using a method (Homebrew, for example) that doesn't require sudo to install global npm packages. |
carlcrott
/ gist:10938412
Created
April 16, 2014 22:16
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| lilith@lilith:~/javascript_projects/node$ ./configure | |
| { 'target_defaults': { 'cflags': [], | |
| 'default_configuration': 'Release', | |
| 'defines': ['OPENSSL_NO_SSL2=1'], | |
| 'include_dirs': [], | |
| 'libraries': []}, | |
| 'variables': { 'clang': 0, | |
| 'gcc_version': 46, | |
| 'host_arch': 'x64', | |
| 'node_install_npm': 'true', |
carlcrott
/ gist:10939107
Created
April 16, 2014 22:29
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| wget http://nodejs.org/dist/v0.10.26/node-v0.10.26.tar.gz | |
| tar -xzvf node-v0.10.26.tar.gz | |
| cd node* | |
| ./configure --prefix=/usr/local && make && make install |
carlcrott
/ gist:10945539
Created
April 17, 2014 00:48
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| lilith@lilith:/usr/local/platform-tools$ ls | |
| adb api fastboot NOTICE.txt source.properties systrace | |
| lilith@lilith:/usr/local/platform-tools$ ./adb | |
| bash: ./adb: No such file or directory | |
| lilith@lilith:/usr/local/platform-tools$ |
carlcrott
/ ladybug_screencap.js
Last active
August 29, 2015 14:00
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| lilith@lilith:~/javascript_projects/junk$ phantomjs ladybug_screencap.js | |
| TypeError: 'undefined' is not a function (evaluating 'this.login.bind(this)') | |
| http://localhost/www/js/angularfire.min.js:1 | |
| http://localhost/www/js/angularfire.min.js:1 | |
| http://localhost/www/js/service.login.js:14 | |
| http://localhost/www/js/app.js:34 | |
| http://localhost/www/js/angular.min.js:34 in d | |
| http://localhost/www/js/angular.min.js:36 | |
| lilith@lilith:~/javascript_projects/junk$ |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| lilith@lilith:~/javascript_projects/screengrab$ phantomjs login.js | |
| step 1 | |
| load started | |
| loading app.js | |
| loading routes.js | |
| loading config.js | |
| loading services.js | |
| loading service.login.js | |
| loading service.firebase.js | |
| loading service.events.js |
carlcrott
/ gist:66fc3a6bc04a6241d48f
Created
July 26, 2014 23:20
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| root@meteorhack-01:/etc/salt# salt '*' grains.get ipv4 | |
| meteorhack-01: | |
| - 10.208.225.53 | |
| - 104.130.3.198 | |
| - 127.0.0.1 |
carlcrott
/ gist:11e9b93b1e265f33930b
Created
August 9, 2014 01:15
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| >BBa_K510044 Part-only sequence (8490 bp) | |
| tactagtagcggccgctgcagtccggcaaaaaaacgggcaaggtgtcaccaccctgccctttttctttaaaaccgaaaagattacttcgcgttatgcagg | |
| cttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaataggccaaccagataagtgaaatct | |
| agttccaaactattttgtcatttttaattttcgtattagcttacgacgctacacccagttcccatctattttgtcactcttccctaaataatccttaaaa | |
| actccatttccacccctcccagttcccaactattttgtccgcccacaggccgcctaggccggaagcataaagtgtaaagcctggggtgcctaatgagtga | |
| gctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagagg | |
| cggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggta | |
| atacggttatccacagaatcaggggataacgcaggaaagaacatgttaaggtatactttccgctgcataaccctgcttcggggtcattatagcgattttt | |
| tcggtatatccatcctttttcgcacgatatacaggattttgccaaagggttcgtgtagactttccttggtgtatccaacggcgtcagccgggcaggatag | |
| gtgaagtaggcccacccgcgagcgggtgttccttcttcactgtcccttattcgcacctggcggtgctcaacgggaatcctgctctgcgaggctggccgat |
OlderNewer