This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
At John Melody Me's Software, one of our main priorities is the privacy of our visitors. This Privacy Policy document contains types of information that is collected and recorded by - and how we use it. | |
If you have additional questions or require more information about our Privacy Policy, do not hesitate to contact us. | |
This Privacy Policy applies only to our online activities and is valid for visitors to our app with regards to the information that they shared and/or collect in -. This policy is not applicable to any information collected offline or via channels other than this app. Our Privacy Policy was created with the help of the Free Privacy Policy Generator. | |
Consent | |
By using our apps, you hereby consent to our Privacy Policy and agree to its terms. | |
Information we collect |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
{ | |
"author": "John Melody Me", | |
"data": [ | |
{ | |
"Location": 1, | |
"Frequency": 462.125, | |
"Duplex": "", | |
"Offset": 0, | |
"Tone": "TSQL", | |
"rToneFreq": 88.5, |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Location | Name | Frequency | Duplex | Offset | Tone | rToneFreq | cToneFreq | DtcsCode | DtcsPolarity | Mode | TStep | Skip | Comment | URCALL | RPT1CALL | RPT2CALL | DVCODE | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1 | 462.125000 | 0.000000 | TSQL | 88.5 | 69.3 | 023 | NN | FM | 5.00 | S | ||||||||
2 | 462.225000 | 0.000000 | 88.5 | 88.5 | 023 | NN | FM | 5.00 | S | |||||||||
3 | 462.325000 | 0.000000 | 88.5 | 88.5 | 023 | NN | FM | 5.00 | S | |||||||||
4 | 462.425000 | 0.000000 | TSQL | 88.5 | 103.5 | 023 | NN | FM | 5.00 | S | ||||||||
5 | 462.525000 | 0.000000 | TSQL | 88.5 | 114.8 | 023 | NN | FM | 5.00 | S | ||||||||
6 | 462.625000 | 0.000000 | TSQL | 88.5 | 127.3 | 023 | NN | FM | 5.00 | S | ||||||||
7 | 462.725000 | 0.000000 | TSQL | 88.5 | 136.5 | 023 | NN | FM | 5.00 | S | ||||||||
8 | 462.825000 | 0.000000 | TSQL | 88.5 | 162.2 | 023 | NN | FM | 5.00 | S | ||||||||
9 | 462.925000 | 0.000000 | DTCS | 88.5 | 88.5 | 023 | NN | FM | 5.00 | S |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
// ignore_for_file: non_constant_identifier_names | |
import 'dart:convert'; | |
List<UserPostsModel> userPostsFromJson(String str) { | |
return List<UserPostsModel>.from(json.decode(str).map((x) { | |
return UserPostsModel.fromJson(x); | |
})); | |
} |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
async get_jnt_tracking() { | |
let result; | |
if ((this.tracking_number) == (undefined)) { | |
result = { | |
message: (err), | |
}; | |
return (result); | |
} else { |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
class Subsettest: | |
def __init__(self, s, t): | |
self.s = s | |
self.t = t | |
n = len(s) # Get The Length of S | |
if(self.issubsetsum(s, n, t) == True): | |
print("The sum of the subset is equal to T") |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
{ | |
"recipe": [ | |
{ | |
"recipe_name": "Spaghetti Pie Casserole", | |
"image_url": "https://www.tasteofhome.com/wp-content/uploads/2018/01/Spaghetti-Pie-Casserole_exps161692_TH2379807A10_31_9bC_RMS-13.jpg", | |
"ingredient": " 1 package (8 ounces) spaghetti\n 1 pound ground beef\n 1 small onion, chopped\n 2 garlic cloves, minced\n 1 jar (14 ounces) spaghetti sauce\n 1/2 teaspoon salt\n 1/4 teaspoon pepper\n 3 ounces reduced-fat cream cheese\n 1 cup reduced-fat sour cream\n 3 green onions, chopped\n 1-1/2 cups shredded cheddar-Monterey Jack cheese", | |
"description": " Cook spaghetti according to package directions; drain. Meanwhile, in a large skillet, cook the beef, onion and garlic over medium heat until beef is no longer pink, 6-8 minutes, breaking up beef into crumbles; drain. Stir in the spaghetti sauce, salt and pepper; bring to a boil. Reduce heat; simmer, uncovered, for 20 minutes, stirring occasionally.\n In a small bowl, mix cream cheese and sour cream |
This file has been truncated, but you can view the full file.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
>JQ765563.1 Human coronavirus NL63 strain NL63/DEN/2009/9, complete genome | |
ACTTTGTGTCTACTCCTCTCAACTAAACGAAATTTTTCTAGTGCTGTCATTTGTTATGGCAGTCCTAGTG | |
TAATTGAAATTTCGTCAAGTTTGTAAACTGGTTAGGCAAGTGTTGTATTTTCTGTGTTTAAGCACTGGTG | |
GTTCTGTCCACTAGTGCACACATTGATACTTAAGTGGTGTTCTGTCACTGCTTATTGTGGAAGCAACGTT | |
CTGTCGTTGTGGAAACCAATAACTGCTAACCATGTTTTACAATCAAGTGACACTTGCTGTTGCAAGTGAT | |
TCGGAAATTTCAGGTTTTGGTTTTGCCATTCCTTCTGTAGCCGTTCGCGCTTATAGCGAAGCCGCTGCAC | |
AAGGTTTTCAGGCATGCCGCTTTGTTGCTTTTGGCTTACAGGATTGTGTAACCGGTATTAATGATGACGA | |
TTATGTCATTGCATTGACTGGTACTAATCAGCTTTGTGCCAAAATTTTACTTTTTTCTGATAGACCTCTT | |
AATTTGCGAGGTTGGCTCATTTTTTCTAACAGCAATTATGTTCTTCAGGACTTTGATGTTGTTTTTGGCC | |
ATGGTGCAGGAAGTGTGGTTTTTGTGGATAAGTATATGTGTGGTTTTGATGGTAAACCTGTGTTACCTAA |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/usr/bin/env bash | |
echo ">>>>>>>BY JOHN MELODY<<<<<<<<<" | |
echo ">>> 正在下载 <<< " | |
sleep 2 | |
sudo apt install apache2 | |
sudo ufw app list | |
sudo ufw allow 'Apache' | |
# sudo ufw status | |
wget https://github.com/coturn/coturn/archive/4.5.1.3.tar.gz |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#include <iostream> | |
#include <ctime> | |
using namespace std; | |
string crackPassword(string pass); | |
long long int attempt; | |
clock_t start_t, end_t; | |
int main(){ | |
string password; |