A deeper exploration of TOPOJSON projections. (see previous) Now with census tract shapefiles taken from the Census Bureau.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
<!DOCTYPE html> | |
<head> | |
<meta charset="utf-8"> | |
<meta http-equiv="x-ua-compatible" content="ie=edge"> | |
<meta name="viewport" content="width=device-width, initial-scale=1"> | |
<link rel="stylesheet" href="http://cdnjs.cloudflare.com/ajax/libs/leaflet/0.7.3/leaflet.css" /> | |
<script src="http://cdnjs.cloudflare.com/ajax/libs/leaflet/0.7.3/leaflet.js"></script> | |
<style> |
This file has been truncated, but you can view the full file.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Name Earnings Title | |
Gilman,Patricia 56,987.55 Professor | |
Gentis,Debra L 48,274.07 IT Specialist II | |
Henderson,Sydney F 22,325.17 IT Support Technician I | |
Carnevale,David G 7,980.67 Professor Emeritus | |
Abdul-Raheem,Latifah L 38,400.00 Grants Specialist I | |
Gross,David S 10,275.00 Professor Emeritus | |
Henderson,Tina M 38,894.96 Admissions/Recruitmt Spec I | |
Vail,Peter C 9,000.00 Adjunct | |
Van Buskirk,Carl B 68,181.24 Tech Project Mgmt Spec III |
This file has been truncated, but you can view the full file.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
>NC_000913.3 Escherichia coli str. K-12 substr. MG1655, complete genome | |
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTG | |
GTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGAC | |
AGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACCATTACCACCACCATCACCATTACCACAGGT | |
AACGGTGCGGGCTGACGCGTACAGGAAACACAGAAAAAAGCCCGCACCTGACAGTGCGGGCTTTTTTTTTCGACCAAAGG | |
TAACGAGGTAACAACCATGCGAGTGTTGAAGTTCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGTGTTGCCG | |
ATATTCTGGAAAGCAATGCCAGGCAGGGGCAGGTGGCCACCGTCCTCTCTGCCCCCGCCAAAATCACCAACCACCTGGTG | |
GCGATGATTGAAAAAACCATTAGCGGCCAGGATGCTTTACCCAATATCAGCGATGCCGAACGTATTTTTGCCGAACTTTT | |
GACGGGACTCGCCGCCGCCCAGCCGGGGTTCCCGCTGGCGCAATTGAAAACTTTCGTCGATCAGGAATTTGCCCAAATAA | |
AACATGTCCTGCATGGCATTAGTTTGTTGGGGCAGTGCCCGGATAGCATCAACGCTGCGCTGATTTGCCGTGGCGAGAAA |
We can't make this file beautiful and searchable because it's too large.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
First Name,Last Name,Salary,Position | |
Patricia,Gilman,"56,987.55",Professor | |
Debra L,Gentis,"48,274.07",IT Specialist II | |
Sydney F,Henderson,"22,325.17",IT Support Technician I | |
David G,Carnevale,"7,980.67",Professor Emeritus | |
Latifah L,Abdul-Raheem,"38,400.00",Grants Specialist I | |
David S,Gross,"10,275.00",Professor Emeritus | |
Tina M,Henderson,"38,894.96",Admissions/Recruitmt Spec I | |
Peter C,Vail,"9,000.00",Adjunct | |
Carl B,Van Buskirk,"68,181.24",Tech Project Mgmt Spec III |
A continuation of my original post. This time with student teacher ratio and an expanded timeline. I'm going to be upgrading this one to version 2.0 of a time slider with a map. Data courtesy of the Oklahoma Policy Institute.
From DocScores API.
You will need star sprite for the star rating to work.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
<!DOCTYPE html> | |
<html> | |
<head> | |
<meta charset="utf-8"> | |
<title>Oklahoma state budget 2013</title> | |
<style type="text/css"> | |
path { | |
stroke: #fff; | |
fill-rule: evenodd; | |
} |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
// basic instance of store in redux | |
const createStore = reducer => { | |
let state; | |
let listeners = []; | |
const getState = () => state; | |
const dispatch = action => { | |
state = reducer(state, action); | |
listeners.forEach(listener => listener()); |
Use CRA to get you going.
$ npx create-react-app component-library
You're going to want styleguidist. Follow the instructions here.
Add .babelrc file to the root of your library.
NewerOlder