This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/usr/bin/env python | |
"""filter a NASP formatted SNP | |
matrix, to only include a list of genomes. | |
The collections module requires Python 2.7+. | |
This script has not been tested with Python 3""" | |
from optparse import OptionParser | |
from collections import deque | |
import sys |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/usr/bin/env python | |
from __future__ import division | |
"""calculates the SNP and homoplash density | |
using a NASP formatted SNP matrix""" | |
import optparse | |
import sys | |
import collections |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/usr/bin/env python | |
"""retrieve only parsimony infomative | |
sites from a nucleotide multiple sequence alignment""" | |
from optparse import OptionParser | |
import sys | |
try: | |
from Bio import SeqIO | |
except: |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#The input is two colums: x and corresponding y values | |
require(MASS) ## for mvrnorm() | |
set.seed(1) | |
mine <- read.table("xy.txt") | |
mine <- data.frame(mine) | |
names(mine) <- c("X","Y") | |
plot(mine) | |
res <- resid(mod <- lm(Y ~ X, data = mine)) | |
res.qt <- quantile(res, probs = c(0.001,0.999)) | |
want <- which(res >= res.qt[1] & res <= res.qt[2]) |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Chromosome start coord end coord #Parsimony-informative SNPs #Homoplasious SNPs Homoplasy density ratio | |
NC_011595 1 1001 3 3 1 | |
NC_011595 1001 2001 2 2 1 | |
NC_011595 2001 3001 5 5 1 | |
NC_011595 3001 4001 2 1 0.5 | |
NC_011595 4001 5001 0 0 0 | |
NC_011595 5001 6001 0 0 0 | |
NC_011595 6001 7001 0 0 0 | |
NC_011595 7001 8001 0 0 0 | |
NC_011595 8001 9001 1 1 1 |
This file has been truncated, but you can view the full file.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
>Burkholderia_ambifaria_2 | |
ATGCTCATGCGGCGGCTTGAGGTGACGTTCCCTTCTGACGGGGACGATTGTGCAGCTTGGCTATACCTTCCGGACACCAGCAGGCCGGCACCGGTGATCGTGATGGCACATGGTCTGGGCGGCACGCGTGAAATGCGACTGGATGCGTTTGCTCACAGATTCTGCGAGGCTGGATTTGCCTGTCTGGTGTTTGATTATCGGCACTTCGGCAGCAGTGGCGGCGAGCCGCGGCAGTTGCTCGATGTAGGCAAGCAGCTACAAGACTGGAGGGCCGCGATAGCATTTGCTCGAACACGAACCGACGTAGACGCAGAGAGATTGATTGTCTGGGGATCGTCGTTTGGGGGAGGGCATGCGCTGACCATCGCGGCCGACAACGCTCACGTGTCCGCGGTCATTGCCCAGTGTCCGTTCACGGATGGGCTGGCTTCCGTTTGCGCTTTACCATTAGGATCGCTAATCAAGGTAACTGCCAGAGCGATCCGCGATCAATTCCGCGCATGGTTGGGAGGGCACCCGGTGACCATCCCGATAGCCGGGAAGCCAGGGGGGGTTGCATTAATGGTGGCTCCTGATGCCGAGCCCGGCTACATGAAGTTGGTGCCGAACGATATGTCAGCCGTCTTTCGTAACTACGTGGCCGCCCGGTTCGCTCTTCAAATTATTCGCTATTTTCCCGGTCGCAAGACTTCACGGATCGCCTGCCCGGTGCTGTTCTGTGTTTGTGATCCTGATACCGTCGCGCCGACGCGTACTACGTTGCGTCACGCAAAACGTGCACCCAAAGGATTGGTGAATATATATCCGTTCGGACATTTCGATATTTATGTCGGTTATGCGTTTGAGCGGGCAGTCAGCGATCAAATCACCTTCCTTCAAAGATTCATTGATTAA | |
>Burkholderia_ambifaria_3 | |
ATGAAATTCGACAACGTCCTGCAGACTATTGGCAATACCCCGATCATCCGCATGAATCGCCTGTTTGGCGCAGACGC |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/usr/bin/python | |
#parses sequence lengths from a file and prints them to the screen | |
#usage python seqlength.py infasta | |
from __future__ import print_function | |
from sys import argv | |
import sys | |
try: | |
from Bio import SeqIO | |
except: | |
print("script requires BioPython to run..exiting") |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/usr/bin/env python | |
"""Transform ribotype data. Input matrix | |
is a transposed output from bac_seq""" | |
from __future__ import print_function | |
from __future__ import division | |
import sys | |
import os | |
import optparse |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
ERR319438 | |
ERR360775 | |
ERR360792 | |
ERR360848 | |
ERR360746 | |
ERR360782 | |
ERR360788 | |
ERR360789 | |
ERR360783 | |
ERR360770 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/usr/bin/env python | |
"""Read counts across a set of reference sequences. | |
Requires Python 2.7 to run""" | |
from __future__ import division | |
from __future__ import print_function | |
from optparse import OptionParser | |
import sys | |
import os |
OlderNewer