Skip to content

Instantly share code, notes, and snippets.

View jni's full-sized avatar

Juan Nunez-Iglesias jni

365 followers · 9 following
View GitHub Profile
@jni
jni / Console output
Created April 7, 2014 00:13
nuneziglesiasj@jni-lscc-mbp Mon Apr 07 10:08
~/projects/scikit-image/skimage/viewer/tests (master)$ python test_viewer.py
Recommended matplotlib backend is `Agg` for full skimage.viewer functionality.
Qt internal error: qt_menu.nib could not be loaded. The .nib file should be placed in QtGui.framework/Versions/Current/Resources/ or in the resources directory of your application bundle.
Abort trap: 6
@jni
jni / islic.py
Last active August 29, 2015 14:03
IPython interact ~~fail~~ success!
%matplotlib inline
from skimage import img_as_float
import numpy as np
from matplotlib import pyplot as plt
def imshow_all(*images, **kwargs):
""" Plot a series of images side-by-side.
Convert all images to float so that images have a common intensity range.
@jni
jni / error
Created January 10, 2015 01:28
sudo py.test fails on Travis
travis@debug-hs-11922-jni-python-1420819368:~/jni/cellom2tif$ py.test
============================= test session starts ==============================
platform linux2 -- Python 2.7.3 -- py-1.4.26 -- pytest-2.6.4
plugins: cov
collected 10 items
verify.py .
cellom2tif/cellom2tif.py ..
tests/test_cellom2tif.py .
tests/test_package.py ..
@jni
jni / output.txt
Created March 16, 2015 22:40
Python generators and piping demo
times2 start
range start
yielding 0
multiplying 0 by 2
yielding 1
multiplying 1 by 2
yielding 2
multiplying 2 by 2
yielding 3
multiplying 3 by 2
@jni
jni / gist:2d407549a3497605281d
Created April 15, 2015 10:53
keybase.md
### Keybase proof
I hereby claim:
* I am jni on github.
* I am jni (https://keybase.io/jni) on keybase.
* I have a public key whose fingerprint is 9917 C047 FE5D 7675 689F 03C1 E6C7 550F 653B E587
To claim this, I am signing this object:
@jni
jni / mb1_dm6.fa
Created September 28, 2015 08:20
First ~1MB of the D. melanogaster genome v6 FASTA file
This file has been truncated, but you can view the full file.
>chr2L
Cgacaatgcacgacagaggaagcagaacagatatttagattgcctctcat
tttctctcccatattatagggagaaatatgatcgcgtatgcgagagtagt
gccaacatattgtgctctttgattttttggcaacccaaaatggtggcgga
tgaaCGAGATGATAATATATTCAAGTTGCCGCTAATCAGAAATAAATTCA
TTGCAACGTTAAATACAGCACAATATATGATCGCGTATGCGAGAGTAGTG
CCAACATATTGTGCTAATGAGTGCCTCTCGTTCTCTGTCTTATATTACCG
CAAACCCAAAAAgacaatacacgacagagagagagagcagcggagatatt
tagattgcctattaaatatgatcgcgtatgcgagagtagtgccaacatat
tgtgctctCTATATAATGACTGCCTCTCATTCTGTCTTATTTTACCGCAA
@jni
jni / throughput.py
Last active September 28, 2015 08:55
Throughput of simple streaming of text data with Toolz/CyToolz
from IPython import get_ipython
import toolz as tz
from toolz import curried as c
fn = 'data/mb1_dm6.fa'
t = get_ipython().magic('timeit -o -q tz.pipe(fn, open, tz.last)')
print('Raw throughput (lines): %.2fMB/s' % (1 / t.best))
t = get_ipython().magic('timeit -o -q tz.pipe(fn, open, tz.concat, tz.last)')
print('Single character throughput: %.2fMB/s' % (1 / t.best))
def is_sequence(line):
return len(line) > 1 and not line.startswith('>')
@jni
jni / Error.txt
Created July 9, 2012 20:43
Failure using @glouppe's cytomine scikit-learn RF shared memory implementation
In [7]: rf = RandomForestClassifier(100, max_depth=20, n_jobs=8, shared=True, compute_importances=True)
In [8]: rf = rf.fit(dat5[0], dat5[1][:, 0])
---------------------------------------------------------------------------
OSError Traceback (most recent call last)
/groups/chklovskii/home/nuneziglesiasj/data/cropped_5um3_larva_fib_10x10x10nm/cl2/<ipython-input-8-16d0d527a259> in <module>()
----> 1 rf = rf.fit(dat5[0], dat5[1][:, 0])
/groups/chklovskii/home/nuneziglesiasj/projects/scikit-learn-sharedmem/sklearn/ensemble/forest.pyc in fit(self, X, y)
273 # Pack inputs into shared-memory arrays
@jni
jni / ZError
Created July 9, 2012 20:36
Attempt to use joblib mmap failed
In [8]: rf = RandomForestClassifier(100, max_depth=20, n_jobs=2, shared=True, compute_importances=True)
In [9]: rf = rf.fit(dat5[0], dat5[1][:, 0])
Exception AttributeError: AttributeError("'NoneType' object has no attribute 'tell'",) in <bound method memmap.__del__ of memmap([ 2.00000000e+00, 1.50000006e-02, 2.25000018e-04,
0.00000000e+00, 5.06250080e-08, 0.00000000e+00,
0.00000000e+00, 0.00000000e+00, 0.00000000e+00,
9.54999954e-01, 1.22499975e-03, 1.11022302e-16,
1.50062439e-06, 3.00000003e-02, 4.00000019e-04,
-1.35525272e-20, 1.60000015e-07, 1.00000000e+00,
0.00000000e+00, 0.00000000e+00, 0.00000000e+00,
@jni
jni / Error compiling skimage with memoryviews
Created May 17, 2013 14:23
~/projects/skimage (3d-slic)$ python setup.py install
non-existing path in 'skimage/_shared': 'tests'
cython -o /Volumes/Projects/skimage/skimage/segmentation/_slic.c /Volumes/Projects/skimage/skimage/segmentation/_slic.pyx
Error compiling Cython file:
------------------------------------------------------------
...
float ratio, int max_iter, int n_segments):
"""Helper function for SLIC segmentation."""