Skip to content

Instantly share code, notes, and snippets.

View nema_gene_name_id.csv
seqid Name
5 Transcript_10 EDO31303
9 Transcript_100 EDO42116
19 Transcript_101 EDO42087
24 Transcript_102 EDO43514
39 Transcript_103 tr|A7SUP6|A7SUP6_NEMVE Predicted protein OS=Nematostella vectensis OX=45351 GN=v1g217764 PE=4 SV=1
58 Transcript_105 EDO33432
60 Transcript_107 tr|A7S0C0|A7S0C0_NEMVE Predicted protein OS=Nematostella vectensis OX=45351 GN=v1g184098 PE=4 SV=1
61 Transcript_109 EDO49229
71 Transcript_11 tr|A7RQ19|A7RQ19_NEMVE Predicted protein OS=Nematostella vectensis OX=45351 GN=v1g239897 PE=4 SV=1
View NEBNextAdapt.fa
>hairpin_1_fwd
GATCGGAAGAGCACACGTCTGAACTCCAGTC
>hairpin_1_revcomp
GACTGGAGTTCAGACGTGTGCTCTTCCGATC
>hairpin_2_fwd
ACACTCTTTCCCTACACGACGCTCTTCCGATC
>hairpin_2_revcomp
GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
>Illumina_top
ACACTCTTTCCCTACACGACGCTCTTCCGATC
View overLapper_original.R
##########################################
## Intersect and Venn Diagram Functions ##
##########################################
## Author: Thomas Girke
## Last update: August 15, 2009
## Utilities:
## (1) Venn Intersects
## Computation of Venn intersects among 2-20 or more sample sets using the typical
## 'only in' intersect logic of Venn comparisons, such as: objects present only in
## set A, objects present only in the intersect of A & B, etc. Due to this restrictive
View plotPCAWithSampleNames.R
# custom script by Igor Dolgolev at NYUMC
plotPCAWithSampleNames = function(x, intgroup="condition", ntop=500)
{
library("genefilter")
library("lattice")
rv = rowVars(assay(x))
select = order(rv, decreasing=TRUE)[seq_len(min(ntop, length(rv)))]
@johnsolk
johnsolk / git_error_solution.md
Created Aug 29, 2016
git error, fatal: HTTP request failed
View git_error_solution.md

Got this error message:


[ljcohen@dev-intel16 Porites_astreoites_larvae_salinity]$ git push origin master
error: The requested URL returned error: 403 Forbidden while accessing https://github.com/ljcohen/Porites_astreoites_larvae_salinity.git/info/refs

fatal: HTTP request failed

Googled problem and found this:

View dammit_gff3_to_trinity_names.py
###################################################################
"""Function: Take in a dammit gff3, dammit fasta, dammit namemap.
Output gff3 and fasta with trinity names.
by Dr. Tessa Pierce
"""
###################################################################
import sys
import os
import argparse
View contig_sigs.py
import screed
import os
from os import path
import subprocess
from subprocess import Popen, PIPE
def make_dir(dirname):
if os.path.isdir(dirname) == False:
os.mkdir(dirname)
print("Directory created:", dirname)
View top_20_barcodes.sh
#outputs top 20 barcodes in file, if there are any
zcat lane1_sample_L001_R1_001.fastq.gz | head -400000 | grep '^@HWI' | cut -d : -f 10 | sort | uniq -c | sort -nr | head -20
View cluster_contigs.ipynb
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
View ONT_DNA_CS.fa
>DNA_CS
GCCATCAGATTGTGTTTGTTAGTCGCTTTTTTTTTTTGGAATTTTTTTTTTGGAATTTTTTTTTTGCGCTAACAACCTCCTGCCGTTTTGCCCGTGCATATCGGTCACGAACAAATCTGATTACTAAACACAGTAGCCTGGATTTGTTCTATCAGTAATCGACCTTATTCCTAATTAAATAGAGCAAATCCCCTTATTGGGGGTAAGACATGAAGATGCCAGAAAAACATGACCTGTTGGCCGCCATTCTCGCGGCAAAGGAACAAGGCATCGGGGCAATCCTTGCGTTTGCAATGGCGTACCTTCGCGGCAGATATAATGGCGGTGCGTTTACAAAAACAGTAATCGACGCAACGATGTGCGCCATTATCGCCTAGTTCATTCGTGACCTTCTCGACTTCGCCGGACTAAGTAGCAATCTCGCTTATATAACGAGCGTGTTTATCGGCTACATCGGTACTGACTCGATTGGTTCGCTTATCAAACGCTTCGCTGCTAAAAAAGCCGGAGTAGAAGATGGTAGAAATCAATAATCAACGTAAGGCGTTCCTCGATATGCTGGCGTGGTCGGAGGGAACTGATAACGGACGTCAGAAAACCAGAAATCATGGTTATGACGTCATTGTAGGCGGAGAGCTATTTACTGATTACTCCGATCACCCTCGCAAACTTGTCACGCTAAACCCAAAACTCAAATCAACAGGCGCCGGACGCTACCAGCTTCTTTCCCGTTGGTGGGATGCCTACCGCAAGCAGCTTGGCCTGAAAGACTTCTCTCCGAAAAGTCAGGACGCTGTGGCATTGCAGCAGATTAAGGAGCGTGGCGCTTTACCTATGATTGATCGTGGTGATATCCGTCAGGCAATCGACCGTTGCAGCAATATCTGGGCTTCACTGCCGGGCGCTGGTTATGGTCAGTTCGAGCATAAGGCTGACAGCCTGATTGCAAAATTCAAAGAAGCGGGCGGAACGGTCAGAGAGATTGATGTATGAGCAGAGTCACCGCGATTATCTCC