Michael T. Wolfinger mtw
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| cat ORIG.gff | perl -ne 'chomp; if($_ =~ /^\#/){print $_."\n";next;} my @F = split("\t"); if ($F[6] eq "+"){$F[6] = "-"}else{$F[6] = "+"};my $part1 = join("\t",$F[0],$F[1],$F[2],$F[3],$F[4],$F[5],$F[6],$F[7],$F[8]);print $part1."\n"' > ! AS.gff |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| #!/bin/bash | |
| fastqcdir="./FastQC" | |
| if [ -d "$fastqcdir" ]; | |
| then | |
| echo "$fastqcdir available" | |
| else | |
| mkdir $fastqcdir | |
| fi |
mtw
/ count_mapped_reads.sh
Last active
December 23, 2015 21:29
Wrapper script for counting mapped reads in a bam file
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| #!/bin/bash | |
| countdir="./count" | |
| count_mapped_reads=`which count_mapped_reads_fast.pl` | |
| bam_stat=`which bam_stat.py` | |
| samtools=`which samtools` | |
| samstats=`which sam-stats` | |
| if [ -d "$countdir" ]; | |
| then | |
| echo "$countdir available" |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| #!/bin/bash | |
| segemehl="/scratch/mtw/src/segemehl-svn/segemehl/segemehl.x" | |
| results="./alignments" | |
| reffa="../../genomes/TAIR10/TAIR10.fa" | |
| refidx="../../genomes/TAIR10/TAIR10.idx" | |
| samples=2 | |
| rep=3 | |
| if [ -d "$results" ]; |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| #!/bin/bash | |
| # generate coverage profiles | |
| vis="./vis" | |
| chromsizes="foo.chrom.sizes" | |
| genomeCoverageBed=`which genomeCoverageBed` | |
| bedGraphToBigWig=`which bedGraphToBigWig` | |
| if ! [ -d "$vis" ]; | |
| then | |
| mkdir -p $vis |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| #!/bin/bash | |
| samdir="./" | |
| annotation="my.gtf" | |
| htseqdir="./htseq-count" | |
| htseqcount=`which htseq-count` | |
| samtools=`which samtools` | |
| feature="gene" | |
| idattr="gene_name" | |
| ss="reverse" |
mtw
/ extract_pp.sh
Created
October 26, 2013 22:05
Extract properly-paired reads and their mates (ie flags 99/147/163/83) from paired-end BAM files
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| #!/bin/bash | |
| samtools=`which samtools` | |
| bn=$(basename $1 .bam) | |
| echo processing $bn | |
| $samtools view -h -b -f99 $1 > $bn.flag99.bam | |
| $samtools view -h -b -f147 $1 > $bn.flag147.bam | |
| $samtools view -h -b -f163 $1 > $bn.flag163.bam | |
| $samtools view -h -b -f83 $1 > $bn.flag83.bam |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| #!/bin/bash | |
| cutadapt=`which cutadapt` | |
| fastqc=`which fastqc` | |
| origdir=".." | |
| results="." | |
| fastqcdir="${results}/FastQC" | |
| adapter5="CTACACTCTTTCCCTACACGACGCTCTTCCGATCT" | |
| adapter3="GATCGGAAGAGCACACGTCTGAACTCCAGTCAC" | |
| inprefix="C" |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| #!/bin/bash | |
| samdir="./" | |
| dexseq_flat_gff="my.DEXSeq.gff" | |
| outdir="./dexseq-count" | |
| dexseq_count="python /home/foo/bin/dexseq_count.py" | |
| samtools=`which samtools` | |
| if ! [ -d "$outdir" ]; | |
| then | |
| mkdir -p $outdir |
mtw
/ bam2fastq_cutadapt.sh
Last active
February 7, 2017 22:56
Raw NGS data is often shipped as unaligned BAM files. This shell script converts raw reads to FASTQ format and trims Illumina adapters with cutadapt. Quality Control is performed with FastQC.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| #!/bin/bash | |
| cutadapt=`which cutadapt` | |
| fastqc=`which fastqc` | |
| bam2fastq=`which bam2fastq` | |
| gzip=`which gzip` | |
| origdir="." | |
| results="cutadapt" | |
| fastqcdir="${results}/FastQC" | |
| adapter5="CTACACTCTTTCCCTACACGACGCTCTTCCGATCT" |
OlderNewer