This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
from Bio.Seq import Seq | |
from Bio import SeqIO | |
oligoTest = ['CCTCTCTATGGGCAGTCGGTGATTAATACGACTCACTATTAGTGGTACGCGCCAGGCTGAAGCGCGTACCAGTTCTGCGGCGTCCGGGTTCTTCTTCTGCGGCATGATCGACTGAGTCGGAGACACGCAGGGATGAGATGG','CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC'] | |
def splitOligo(oligolist,oligo_overlap): | |
splitList = [] | |
for oligo in oligolist: | |
for x in range((len(oligo)-20)): | |
left = oligo[:20+x] |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
class RobExample: # define the class | |
def __init__(self,color,shape): #tell the object what to do when initialized | |
self.color = color; | |
self.shape = shape; | |
def drawShape(self): | |
print "I am printing a", self.color, self.shape | |
def main(): |