This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
provider "aws" { | |
access_key = "${var.access_key}" | |
secret_key = "${var.secret_key}" | |
region="${var.aws_region}" | |
} | |
resource "aws_security_group" "default" { | |
name = "salt_master_sg" | |
description = "Security group for the Salt Master Node" |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT f8696c79-b162-92a6-e040-11ac0c4804bf | |
1 10004 . T??@̨?? ??X焙D?V????4??ğ?]ګ??V???O??????N#???M?R2#MO?????KKFB??T???5??Y?HG?*?̤#R??K???? CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCT 0 . AB=0;ABP=0;AC=2;AF=1;AN=2;AO=5;CIGAR=100X;DP=7;DPB=41.36;DPRA=0;EPP=0;EPPR=0;GTI=0;LEN=100;MEANALT=3;MQM=29;MQMR=0;NS=1;NUMALT=1;ODDS=52.6792;PAIRED=1;PAIREDR=0;PAO=66;PQA=862;PQR=0;PRO=0;QA=42;QR=0;RO=0;RPL=5;RPP=13.8677;RPPR=0;RPR=0;RUN=1;SAF=5;SAP=13.8677;SAR=0;SRF=0;SRP=0;SRR=0;TYPE=mnp;technology.ILLUMINA=1 GT:DP:RO:QR:AO:QA:GL 1/1:7:0:0:5:42:0 | |
1 10123 . T C 0 . AB=0;ABP=0;AC=2;AF=1;AN=2;AO=119;CIGAR=1X;DP=120;DPB=120;DPRA=0;EPP=43.3194;EPPR=0;GTI=0;LEN=1;MEANALT=2;MQM=20.0672;MQMR=0;NS=1;NUMALT=1;ODDS=69.9353;PAIRED=0.378151;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=852;QR=0;RO=0;RPL=105;RPP=154.119;RPPR=0;RPR=14;RUN=1;SAF=40;SAP=30.765;SAR=79;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.ILLUMINA=1 GT:DP:RO:QR:AO:QA:GL 1/1:120:0:0:119: |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
[root@genotyper-8 centos]# zcat /reference/genome.fa.gz | grep chromosome | |
>1 dna:chromosome chromosome:GRCh37:1:1:249250621:1 | |
>2 dna:chromosome chromosome:GRCh37:2:1:243199373:1 | |
>3 dna:chromosome chromosome:GRCh37:3:1:198022430:1 | |
>4 dna:chromosome chromosome:GRCh37:4:1:191154276:1 | |
>5 dna:chromosome chromosome:GRCh37:5:1:180915260:1 | |
>6 dna:chromosome chromosome:GRCh37:6:1:171115067:1 | |
>7 dna:chromosome chromosome:GRCh37:7:1:159138663:1 | |
>8 dna:chromosome chromosome:GRCh37:8:1:146364022:1 | |
>9 dna:chromosome chromosome:GRCh37:9:1:141213431:1 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
from airflow import DAG | |
from airflow.operators import BashOperator, PythonOperator | |
from datetime import datetime, timedelta | |
from sqlalchemy.ext.automap import automap_base | |
from sqlalchemy.orm import Session | |
from sqlalchemy import create_engine | |
from sqlalchemy import or_, and_ | |
from os import system | |
# Commenting out full list of contigs for now leaving only 1-22, X, Y | |
#contig_names = ["1","2","3","4","5","6","7","8","9","10","11","12","13","14","15","16","17","18","19","20","21","22","X","Y","MT","GL000207.1","GL000226.1","GL000229.1","GL000231.1","GL000210.1","GL000239.1","GL000235.1","GL000201.1","GL000247.1","GL000245.1","GL000197.1","GL000203.1","GL000246.1","GL000249.1","GL000196.1","GL000248.1","GL000244.1","GL000238.1","GL000202.1","GL000234.1","GL000232.1","GL000206.1","GL000240.1","GL000236.1","GL000241.1","GL000243.1","GL000242.1","GL000230.1","GL000237.1","GL000233.1","GL000204.1","GL000198.1","GL000208.1","GL000191.1","GL000227.1","GL000228.1","GL000214.1","GL000221.1","GL000209.1","GL000218.1","GL0 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
from airflow import DAG | |
from airflow.operators import BashOperator, PythonOperator | |
from datetime import datetime, timedelta | |
from sqlalchemy.ext.automap import automap_base | |
from sqlalchemy.orm import Session | |
from sqlalchemy import create_engine | |
from sqlalchemy import or_, and_ | |
from os import system | |
# Commenting out full list of contigs for now leaving only 1-22, X, Y | |
#contig_names = ["1","2","3","4","5","6","7","8","9","10","11","12","13","14","15","16","17","18","19","20","21","22","X","Y","MT","GL000207.1","GL000226.1","GL000229.1","GL000231.1","GL000210.1","GL000239.1","GL000235.1","GL000201.1","GL000247.1","GL000245.1","GL000197.1","GL000203.1","GL000246.1","GL000249.1","GL000196.1","GL000248.1","GL000244.1","GL000238.1","GL000202.1","GL000234.1","GL000232.1","GL000206.1","GL000240.1","GL000236.1","GL000241.1","GL000243.1","GL000242.1","GL000230.1","GL000237.1","GL000233.1","GL000204.1","GL000198.1","GL000208.1","GL000191.1","GL000227.1","GL000228.1","GL000214.1","GL000221.1","GL000209.1","GL000218.1","GL0 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
siakhnin@mac-korbel21:~/Documents/workspace/butler/provision/terraform/collaboratory/salt-master$ terraform apply -var-file ../collaboratory_credentials.tfvars | |
2017/01/12 20:57:42 [INFO] Terraform version: 0.8.4 a791ff09b29d063dd4b6da0cac04ad3b83c836f5 | |
2017/01/12 20:57:42 [INFO] CLI args: []string{"/Users/siakhnin/Documents/workspace/go/bin/terraform", "apply", "-var-file", "../collaboratory_credentials.tfvars"} | |
2017/01/12 20:57:42 [DEBUG] Detected home directory from env var: /Users/siakhnin | |
2017/01/12 20:57:42 [DEBUG] Detected home directory from env var: /Users/siakhnin | |
2017/01/12 20:57:42 [DEBUG] Attempting to open CLI config file: /Users/siakhnin/.terraformrc | |
2017/01/12 20:57:42 [DEBUG] File doesn't exist, but doesn't need to. Ignoring. | |
2017/01/12 20:57:42 [DEBUG] Detected home directory from env var: /Users/siakhnin | |
2017/01/12 20:57:42 [DEBUG] New state was assigned lineage "f6c68402-6178-44d5-8809-a7d75fcb98cd" | |
var.salt_master_ip |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
... | |
class URLPrefixMiddleware(object): | |
def __init__(self, app, prefix=''): | |
self.app = app | |
self.prefix = prefix | |
def __call__(self, environ, start_response): | |
if environ['PATH_INFO'].startswith(self.prefix): |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
upstream chronograf { | |
server influxdb.service.consul:8888; | |
} | |
upstream rabbitmq { | |
server rabbitmq.service.consul:15672; | |
} | |
upstream airflow { | |
server airflow.service.consul:8889; |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
{ | |
"__schema":{ | |
"queryType":{ | |
"name":"Query" | |
}, | |
"mutationType":{ | |
"name":"MyMutations" | |
}, | |
"subscriptionType":null, | |
"types":[ |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
class EditableCell extends React.Component { | |
state = { | |
value: this.props.value, | |
editable: this.props.editable || false, | |
}; | |
componentWillReceiveProps(nextProps) { | |
if (nextProps.editable !== this.state.editable) { | |
this.setState({ editable: nextProps.editable }); | |
if (nextProps.editable) { | |
this.cacheValue = this.state.value; |
OlderNewer