This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
def set_up_dag_run(context, dag_run_obj): | |
dag_run_obj.payload = {"config": context["config"]} | |
dag_run_obj.run_id = str(uuid4()) | |
print context | |
return dag_run_obj | |
def launch_workflow_command(args): | |
config_location = args.config_location | |
analysis_id = args.analysis_id |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
from airflow import DAG | |
from airflow.operators import BashOperator, PythonOperator | |
from datetime import datetime, timedelta | |
from sqlalchemy.ext.automap import automap_base | |
from sqlalchemy.orm import Session | |
from sqlalchemy import create_engine | |
from sqlalchemy import or_, and_ | |
from os import system | |
# Commenting out full list of contigs for now leaving only 1-22, X, Y | |
#contig_names = ["1","2","3","4","5","6","7","8","9","10","11","12","13","14","15","16","17","18","19","20","21","22","X","Y","MT","GL000207.1","GL000226.1","GL000229.1","GL000231.1","GL000210.1","GL000239.1","GL000235.1","GL000201.1","GL000247.1","GL000245.1","GL000197.1","GL000203.1","GL000246.1","GL000249.1","GL000196.1","GL000248.1","GL000244.1","GL000238.1","GL000202.1","GL000234.1","GL000232.1","GL000206.1","GL000240.1","GL000236.1","GL000241.1","GL000243.1","GL000242.1","GL000230.1","GL000237.1","GL000233.1","GL000204.1","GL000198.1","GL000208.1","GL000191.1","GL000227.1","GL000228.1","GL000214.1","GL000221.1","GL000209.1","GL000218.1","GL0 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
from airflow import DAG | |
from airflow.operators import BashOperator, PythonOperator | |
from datetime import datetime, timedelta | |
from sqlalchemy.ext.automap import automap_base | |
from sqlalchemy.orm import Session | |
from sqlalchemy import create_engine | |
from sqlalchemy import or_, and_ | |
from os import system | |
# Commenting out full list of contigs for now leaving only 1-22, X, Y | |
#contig_names = ["1","2","3","4","5","6","7","8","9","10","11","12","13","14","15","16","17","18","19","20","21","22","X","Y","MT","GL000207.1","GL000226.1","GL000229.1","GL000231.1","GL000210.1","GL000239.1","GL000235.1","GL000201.1","GL000247.1","GL000245.1","GL000197.1","GL000203.1","GL000246.1","GL000249.1","GL000196.1","GL000248.1","GL000244.1","GL000238.1","GL000202.1","GL000234.1","GL000232.1","GL000206.1","GL000240.1","GL000236.1","GL000241.1","GL000243.1","GL000242.1","GL000230.1","GL000237.1","GL000233.1","GL000204.1","GL000198.1","GL000208.1","GL000191.1","GL000227.1","GL000228.1","GL000214.1","GL000221.1","GL000209.1","GL000218.1","GL0 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
[root@genotyper-8 centos]# zcat /reference/genome.fa.gz | grep chromosome | |
>1 dna:chromosome chromosome:GRCh37:1:1:249250621:1 | |
>2 dna:chromosome chromosome:GRCh37:2:1:243199373:1 | |
>3 dna:chromosome chromosome:GRCh37:3:1:198022430:1 | |
>4 dna:chromosome chromosome:GRCh37:4:1:191154276:1 | |
>5 dna:chromosome chromosome:GRCh37:5:1:180915260:1 | |
>6 dna:chromosome chromosome:GRCh37:6:1:171115067:1 | |
>7 dna:chromosome chromosome:GRCh37:7:1:159138663:1 | |
>8 dna:chromosome chromosome:GRCh37:8:1:146364022:1 | |
>9 dna:chromosome chromosome:GRCh37:9:1:141213431:1 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT f8696c79-b162-92a6-e040-11ac0c4804bf | |
1 10004 . T??@̨?? ??X焙D?V????4??ğ?]ګ??V???O??????N#???M?R2#MO?????KKFB??T???5??Y?HG?*?̤#R??K???? CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCT 0 . AB=0;ABP=0;AC=2;AF=1;AN=2;AO=5;CIGAR=100X;DP=7;DPB=41.36;DPRA=0;EPP=0;EPPR=0;GTI=0;LEN=100;MEANALT=3;MQM=29;MQMR=0;NS=1;NUMALT=1;ODDS=52.6792;PAIRED=1;PAIREDR=0;PAO=66;PQA=862;PQR=0;PRO=0;QA=42;QR=0;RO=0;RPL=5;RPP=13.8677;RPPR=0;RPR=0;RUN=1;SAF=5;SAP=13.8677;SAR=0;SRF=0;SRP=0;SRR=0;TYPE=mnp;technology.ILLUMINA=1 GT:DP:RO:QR:AO:QA:GL 1/1:7:0:0:5:42:0 | |
1 10123 . T C 0 . AB=0;ABP=0;AC=2;AF=1;AN=2;AO=119;CIGAR=1X;DP=120;DPB=120;DPRA=0;EPP=43.3194;EPPR=0;GTI=0;LEN=1;MEANALT=2;MQM=20.0672;MQMR=0;NS=1;NUMALT=1;ODDS=69.9353;PAIRED=0.378151;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=852;QR=0;RO=0;RPL=105;RPP=154.119;RPPR=0;RPR=14;RUN=1;SAF=40;SAP=30.765;SAR=79;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.ILLUMINA=1 GT:DP:RO:QR:AO:QA:GL 1/1:120:0:0:119: |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
provider "aws" { | |
access_key = "${var.access_key}" | |
secret_key = "${var.secret_key}" | |
region="${var.aws_region}" | |
} | |
resource "aws_security_group" "default" { | |
name = "salt_master_sg" | |
description = "Security group for the Salt Master Node" |
NewerOlder