HelBorn

import re
 
# Your protein input sequence. This should be replaced with something like raw_input(""),
# but for this demo I just typed the string in.
sequence = "AUGCAAGGUACUUUCAGUUGACAAUAG"   # Valid protein
#sequence = "AUGCAAGGUACUUUCAGUUGACAACAA"  # Invalid protein
 
# Performs the search. The first argument is the regular expression (regex)
# and the second argument is the sequence (as seen above).
m = re.search(r'^(AUG([ACGU]{3,})(UAA|UAG|UGA))$', sequence)

HelBorn

final def KAPREKARS_CONSTANT = "6174"
final def MAX_ITERATIONS = 7

def startingDigits = "1123"
def iterations = 0
def solved = false

println "Attempting to solve ${startingDigits}:"

for(res = startingDigits; iterations < MAX_ITERATIONS && !solved; iterations++) {

HelBorn

import org.powerbot.game.bot.Context;

import java.awt.event.MouseListener;

/**
 * @author HelBorn
 */
public class MouseBlock {
	private static MouseListener mouseListener;
	private static boolean enabled;

HelBorn

using System;
using System.Collections.Generic;
using System.Text;
using System.Windows.Forms;
using Microsoft.Win32;

namespace RunOnStartup
{
    /// <summary>
    /// It attempts to write to HKEY_LOCAL_MACHINE first, which will run on startup on all user accounts.