Built with blockbuilder.org
Last active
February 8, 2018 17:18
-
-
Save Heywhoyou22/44b460143dde87388117f7ef56fb5a58 to your computer and use it in GitHub Desktop.
Genome Browser
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
license: mit |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
<!DOCTYPE html> | |
<head> | |
<meta charset="utf-8"> | |
<script src="https://d3js.org/d3.v4.min.js"></script> | |
<style> | |
body { margin:0;position:fixed;top:0;right:0;bottom:0;left:0; } | |
</style> | |
</head> | |
<body> | |
<script> | |
var ruler1000=[] | |
var ruler100=[] | |
var ruler500=[] | |
var bleh=d3.range(10000) | |
for (v in bleh) | |
if (v%1000==0)(ruler1000.push[v]) | |
else if (v%500==0)(ruler500.push[v]) | |
else if (v%100==0)(ruler100.push[v]) | |
var Ruler={width:800,height:50} | |
var Genes=[ | |
{name:"1",start:50,sequence:"ATGCTAGCGGAT",direction:"F",function:"Hair cell gene"}, {name:"2",start:250,sequence:"ACTGCACGGGA",direction:"R",function:"Skin cell gene"},{name:"3",start:250,sequence:"GATAGCTGAC",direction:"F",function:"Hair color gene"},{name:"4",start:450,sequence:"TGAAGCTTAGTCTAGCTGAGCTAGGAC",direction:"F",function:"Stomach cell gene"}] | |
var svg = d3.select("body").append("svg") | |
.attr("width", 1000) | |
.attr("height", 500) | |
svg.selectAll("fool") | |
.data(Genes) | |
.enter() | |
.append("rect") | |
.attr("y",function(v){if (v.direction=="F"){return 100;}else{return 300;}}) | |
.attr("x",function(v){if (v.direction=="F"){return 1000;}else{return -1-((v.sequence.length)*13);}}) | |
.attr("width",function(v){return 20+(v.sequence.length)*11}) | |
.attr("height",50) | |
.attr("fill",function(v){if (v.direction=="F"){return "green";}else{return "red";}}) | |
.attr("fill-opacity",.5) | |
.attr("stroke","black") | |
.attr("stroke-width",1) | |
.transition() | |
.duration(1500) | |
.attr("x",function(v){return v.start;}) | |
.delay(function(v,i){return i*1000;}) | |
; | |
svg.selectAll("Sequences") | |
.data(Genes) | |
.enter() | |
.append("text") | |
.text(function(v){return v.sequence}) | |
.attr("y",function(v){if (v.direction=="F"){return 130;}else{return 330;}}) | |
.attr("x",function(v){if (v.direction=="F"){return 1000;}else{return -1-((v.sequence.length)*13);}}) | |
.attr("font-size", 20) | |
.attr("font-family", "monospace") | |
.transition() | |
.duration(1500) | |
.attr("x",function(v){return v.start+10}) | |
.delay(function(v,i){return i*1000;}) | |
; | |
svg.selectAll("Functions") | |
.data(Genes) | |
.enter() | |
.append("text") | |
.text(function(v){return v.function}) | |
.attr("y",function(v){if (v.direction=="F"){return 90;}else{return 290;}}) | |
.attr("x",function(v){if (v.direction=="F"){return 1000;}else{return -1-((v.sequence.length)*13);}}) | |
.attr("font-size", 20) | |
.attr("font-family", "monospace") | |
.transition() | |
.duration(1500) | |
.attr("x",function(v){return v.start}) | |
.delay(function(v,i){return i*1000;}) | |
; | |
svg.append("rect") | |
.attr("y", 200) | |
.attr("x", 50) | |
.attr("width",Ruler.width) | |
.attr("height",Ruler.height) | |
.attr("fill-opacity","0") | |
.attr("stroke","white") | |
.transition() | |
.duration(1500) | |
.attr("fill-opacity","0.3") | |
.attr("stroke","black") | |
; | |
svg.selectAll("ruler") | |
.data(ruler1000) | |
.enter() | |
.append("rect") | |
.attr("fill","black") | |
.attr("width",2) | |
.attr("height",50) | |
.attr("y",200) | |
.attr("x", function(v) {return v/10}) | |
; | |
svg.append("text") | |
.text("Genome Browser") | |
.attr("y", 50) | |
.attr("x", 120) | |
.attr("font-size", 36) | |
.attr("font-family", "monospace") | |
; | |
</script> | |
</body> |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment