Ibrahim Tanyalcin IbrahimTanyalcin
☸️
IbrahimTanyalcin
/ example.fas
Last active
July 13, 2023 13:45
a large example fasta file (repeated brca1)
View example.fas
This file has been truncated, but you can view the full file.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| >Repeated BRCA1 | |
| GTACCTTGATTTCGTATTCTGAGAGGCTGCTGCTTAGCGGTAGCCCCTTGGTTTCCGTGGCAACGGAAAAGCGCGGGAAT | |
| TACAGATAAATTAAAACTGCGACTGCGCGGCGTGAGCTCGCTGAGACTTCCTGGACGGGGGACAGGCTGTGGGGTTTCTC | |
| AGATAACTGGGCCCCTGCGCTCAGGAGGCCTTCACCCTCTGCTCTGGGTAAAGTTCATTGGAACAGAAAGAAATGGATTT | |
| ATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTAGAGTGTCCCATCTGTCTGGAGT | |
| TGATCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAAATTTTGCATGCTGAAACTTCTCAACCAGAAGAAA | |
| GGGCCTTCACAGTGTCCTTTATGTAAGAATGATATAACCAAAAGGAGCCTACAAGAAAGTACGAGATTTAGTCAACTTGT | |
| TGAAGAGCTATTGAAAATCATTTGTGCTTTTCAGCTTGACACAGGTTTGGAGTATGCAAACAGCTATAATTTTGCAAAAA | |
| AGGAAAATAACTCTCCTGAACATCTAAAAGATGAAGTTTCTATCATCCAAAGTATGGGCTACAGAAACCGTGCCAAAAGA | |
| CTTCTACAGAGTGAACCCGAAAATCCTTCCTTGCAGGAAACCAGTCTCAGTGTCCAACTCTCTAACCTTGGAACTGTGAG |
IbrahimTanyalcin
/ defPointAlongPath_fast_many.html
Created
September 14, 2018 14:59
Performance comparsion of SVG point along path - fast version
View defPointAlongPath_fast_many.html
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| <!DOCTYPE html> | |
| <meta charset="utf-8"> | |
| <body> | |
| <style> | |
| path { | |
| fill: none; | |
| stroke: #000; | |
| stroke-width: 3px; | |
| } |
IbrahimTanyalcin
/ defPointAlongPath_many.html
Created
September 14, 2018 14:53
Performance comparison of SVG point along path - default
View defPointAlongPath_many.html
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| <!DOCTYPE html> | |
| <meta charset="utf-8"> | |
| <body> | |
| <style> | |
| path { | |
| fill: none; | |
| stroke: #000; | |
| stroke-width: 3px; | |
| } |
View B.js
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| !function(){ | |
| function X(exportA){ | |
| var div = document.body.lastElementChild.appendChild(document.createElement("div")); | |
| div.textContent = "B\n\u21e9"; | |
| taskq.export({},"exportB"); | |
| } | |
| X._taskqId = document.currentScript.dataset.taskqid; | |
| X._taskqWaitFor = document.currentScript.dataset.taskqwaitfor.split(",").filter(d=>d); | |
| taskq.push(X); | |
| }() |
View C.js
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| !function(){ | |
| function X(exportA,exportB){ | |
| var div = document.body.lastElementChild.appendChild(document.createElement("div")); | |
| div.textContent = "C\n\u21e9"; | |
| taskq.export({},"exportC"); | |
| } | |
| X._taskqId = document.currentScript.dataset.taskqid; | |
| X._taskqWaitFor = document.currentScript.dataset.taskqwaitfor.split(",").filter(d=>d); | |
| taskq.push(X); | |
| }() |
View A.js
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| !function(){ | |
| function X(){ | |
| var div = document.body.lastElementChild.appendChild(document.createElement("div")); | |
| div.textContent = "A\n\u21e9"; | |
| taskq.export({},"exportA"); | |
| } | |
| X._taskqId = document.currentScript.dataset.taskqid; | |
| X._taskqWaitFor = document.currentScript.dataset.taskqwaitfor.split(",").filter(d=>d); | |
| taskq.push(X); | |
| }() |
IbrahimTanyalcin
/ minimal.html
Created
July 15, 2018 13:34
minimal.html for declarative dependencies for Taskq.js
View minimal.html
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| <!DOCTYPE html> | |
| <html lang="en" style="font-size:18px;"> | |
| <head> | |
| <meta charset="utf-8"> | |
| <style> | |
| body>div:nth-child(2)>div { | |
| float:left; | |
| width:60px; | |
| heigth:60px; | |
| box-sizing:border-box; |
IbrahimTanyalcin
/ someOtherProcess.js
Created
April 18, 2018 12:52
Taskq -> Medium -> Part3 -> NonRenderBlocking -> someOtherProcess.js
View someOtherProcess.js
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| !function(){ | |
| function someOtherProcess(){ | |
| texts && texts.forEach(function(d,i){ | |
| var p = document.createElement("p"); | |
| p.textContent = d; | |
| document.body.firstElementChild.appendChild(p); | |
| }); | |
| } | |
| someOtherProcess._taskqId = "someOtherProcess"; | |
| someOtherProcess._taskqWaitFor = ["nonRenderBlocking"]; |
IbrahimTanyalcin
/ nonRenderBlocking.js
Created
April 18, 2018 12:10
Taskq -> Medium -> Part3 -> NonRenderBlocking -> nonRenderBlocking.js
View nonRenderBlocking.js
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| !function(){ | |
| function nonRenderBlocking(){ | |
| taskq.load("./script0.js"); | |
| taskq.load("./script1.js"); | |
| taskq.load("./script2.js"); | |
| } | |
| nonRenderBlocking._taskqId = "nonRenderBlocking"; | |
| taskq.push(nonRenderBlocking); | |
| }(); |
IbrahimTanyalcin
/ minimal.html
Created
April 17, 2018 12:44
Taskq -> Medium -> Part3 -> NonRenderBlocking -> minimal.html
View minimal.html
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| <!DOCTYPE html> | |
| <html lang="en" style="font-size:24px;"> | |
| <head> | |
| <meta charset="utf-8"> | |
| <style> | |
| </style> | |
| </head> | |
| <body> | |
| <div class="row" style="text-align:center;padding:100px;font-size:1rem;line-height:200%;font-family:Helvetica,Arial;color:DimGray"></div> | |
| <script type="text/javascript" src="../../../taskq.js" charset="UTF-8"></script> |
NewerOlder