Created
September 5, 2019 20:03
-
-
Save Lucs1590/9f041e35ab4baa76cdb58c4cfaa45398 to your computer and use it in GitHub Desktop.
Esse código separa os ribossomos de uma sequencia de DNA
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
def gerar_nos(seq, arr= []): | |
seq = list(seq) | |
saida_array = seq[:3] | |
arr.append(''.join(saida_array)) | |
if len(seq) == 3: | |
return arr | |
seq.pop(0) | |
return gerar_nos(seq) | |
sequencia = 'ACACACGAUGCACGAUGCACACGAUGCA' | |
print(gerar_nos(sequencia)) |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment