vg Dockerfile make test failure

Make errors.md

Step 10 : RUN make test
 ---> Running in 389178ea0b21
if [ ! -d bin ]; then mkdir -p bin; fi
if [ ! -d lib ]; then mkdir -p lib; fi
if [ ! -d obj ]; then mkdir -p obj; fi
if [ ! -d obj/unittest ]; then mkdir -p obj/unittest; fi
if [ ! -d include ]; then mkdir -p include; fi
if [ ! -d cpp ]; then mkdir -p cpp; fi
/bin/sh: 1: git: not foundecho "#define VG_GIT_VERSION \"unknown\"" > include/vg_git_version.hpp

. ./source_me.sh && g++ -O3 -msse4.1 -fopenmp -std=c++11 -ggdb -g -c -o obj/version.o src/version.cpp -I/app/include -I. -I/app/src -I/app/src/unittest -I/app/cpp -I/app/include/dynamic -I/app/include/sonLib -ggdb -L/app/lib -lvcflib -lgssw -lssw -lprotobuf -lhts -lpthread -ljansson -lncurses -lrocksdb -lsnappy -lz -lbz2 -lgcsa2 -lxg -ldivsufsort -ldivsufsort64 -lvcfh -lgfakluge -lraptor2 -lsupbub -lsdsl -lpinchesandcacti -l3edgeconnected  -lsonlib -lrt -Wl,-rpath,/app/lib  
ar rs lib/libvg.a obj/gssw_aligner.o obj/vg.o cpp/vg.pb.o obj/index.o obj/mapper.o obj/region.o obj/progress_bar.o obj/vg_set.o obj/utility.o obj/path.o obj/alignment.o obj/edit.o obj/sha1.o obj/json2pb.o obj/entropy.o obj/pileup.o obj/caller.o obj/call2vcf.o obj/genotyper.o obj/genotypekit.o obj/position.o obj/deconstructor.o obj/vectorizer.o obj/sampler.o obj/filter.o obj/readfilter.o obj/ssw_aligner.o obj/bubbles.o obj/translator.o obj/version.o obj/banded_global_aligner.o
. ./source_me.sh && g++ -O3 -msse4.1 -fopenmp -std=c++11 -ggdb -g -o bin/vg obj/main.o obj/unittest/driver.o obj/unittest/distributions.o obj/unittest/genotypekit.o obj/unittest/readfilter.o obj/unittest/banded_global_aligner.o obj/unittest/pinned_alignment.o obj/unittest/vg.o -lvg -I/app/include -I. -I/app/src -I/app/src/unittest -I/app/cpp -I/app/include/dynamic -I/app/include/sonLib -ggdb -L/app/lib -lvcflib -lgssw -lssw -lprotobuf -lhts -lpthread -ljansson -lncurses -lrocksdb -lsnappy -lz -lbz2 -lgcsa2 -lxg -ldivsufsort -ldivsufsort64 -lvcfh -lgfakluge -lraptor2 -lsupbub -lsdsl -lpinchesandcacti -l3edgeconnected  -lsonlib -lrt -Wl,-rpath,/app/lib  
. ./source_me.sh && g++ -O3 -msse4.1 -fopenmp -std=c++11 -ggdb -g -o test/build_graph test/build_graph.cpp -I/app/include -I. -I/app/src -I/app/src/unittest -I/app/cpp -I/app/include/dynamic -I/app/include/sonLib -lvg -ggdb -L/app/lib -lvcflib -lgssw -lssw -lprotobuf -lhts -lpthread -ljansson -lncurses -lrocksdb -lsnappy -lz -lbz2 -lgcsa2 -lxg -ldivsufsort -ldivsufsort64 -lvcfh -lgfakluge -lraptor2 -lsupbub -lsdsl -lpinchesandcacti -l3edgeconnected  -lsonlib -lrt -Wl,-rpath,/app/lib  
ln -s `which shuf` bin/shuf
. ./source_me.sh && cd test && make
make[1]: Entering directory '/app/test'
prove -v t
t/00_unittest.t ...... 
1..1
===============================================================================
All tests passed (5001 assertions in 13 test cases)
ok 1 - vg unit tests complete successfully
ok
t/01_build_graph.t ... 
1..1
ok 1 - graph building with the API
ok
make[2]: git: Command not found
make[3]: git: Command not found
Fasta.cpp: In member function 'std::__cxx11::string FastaReference::getSequence(std::__cxx11::string)':
Fasta.cpp:254:43: warning: ignoring return value of 'size_t fread(void*, size_t, size_t, FILE*)', declared with attribute warn_unused_result [-Wunused-result]
     fread(seq, sizeof(char), seqlen, file);
                                           ^
Fasta.cpp: In member function 'std::__cxx11::string FastaReference::getSubSequence(std::__cxx11::string, int, int)':
Fasta.cpp:301:51: warning: ignoring return value of 'size_t fread(void*, size_t, size_t, FILE*)', declared with attribute warn_unused_result [-Wunused-result]
     fread(seq, sizeof(char), (off_t) seqlen, file);
                                                   ^
t/02_vg_construct.t .. 
1..22
ok 1 - construction produces the right number of nodes
ok 2 - construction produces the right number of edges
ok 3 - construction of a 1 megabase graph from the 1000 Genomes succeeds
ok 4 - the 1mb graph has the expected number of nodes
ok 5 - the 1mb graph has the expected number of edges
ok 6 - node size is manageable by default
ok 7 - construction of a very complex region succeeds
ok 8 - the complex graph has the expected number of nodes
ok 9 - the complex graph has the expected number of edges
ok 10 - the ordering of variants at the same position has no effect on the resulting graph
ok 11 - construction does not fail when the first position in the VCF is repeated and has an indel
ok 12 - the size of the regions used in construction has no effect on the graph
ok 13 - the number of threads used in construction has no effect on the graph
ok 14 - the number of threads and regions used in construction has no effect on the graph
ok 15 - construction of a graph with two head nodes succeeds
make[2]: Entering directory '/app/deps/vcflib'
if [ ! -d bin ]; then mkdir -p bin; fi
if [ ! -d lib ]; then mkdir -p lib; fi
if [ ! -d include ]; then mkdir -p include; fi
if [ ! -d obj ]; then mkdir -p obj; fi
make bin/vcf2tsv
make[3]: Entering directory '/app/deps/vcflib'
if [ ! -d bin ]; then mkdir -p bin; fi
if [ ! -d lib ]; then mkdir -p lib; fi
if [ ! -d include ]; then mkdir -p include; fi
if [ ! -d obj ]; then mkdir -p obj; fi
cd tabixpp && make && cp *.h* /app/deps/vcflib/include/
make[4]: Entering directory '/app/deps/vcflib/tabixpp'
make[5]: Entering directory '/app/deps/vcflib/tabixpp'
make[5]: Nothing to be done for 'all'.
make[5]: Leaving directory '/app/deps/vcflib/tabixpp'
make[4]: Leaving directory '/app/deps/vcflib/tabixpp'
cd multichoose && make && cp *.h* /app/deps/vcflib/include/
make[4]: Entering directory '/app/deps/vcflib/multichoose'
make[4]: Nothing to be done for 'all'.
make[4]: Leaving directory '/app/deps/vcflib/multichoose'
cd smithwaterman && make && cp *.h* /app/deps/vcflib/include/ && cp *.o /app/deps/vcflib/obj/
make[4]: Entering directory '/app/deps/vcflib/smithwaterman'
g++ -O3 -c -o smithwaterman.o smithwaterman.cpp -I.
g++ -O3 -c -o SmithWatermanGotoh.o SmithWatermanGotoh.cpp -I.
g++ -O3 smithwaterman.o BandedSmithWaterman.o SmithWatermanGotoh.o disorder.o LeftAlign.o Repeats.o IndelAllele.o -I. -o smithwaterman
ld -r BandedSmithWaterman.o SmithWatermanGotoh.o LeftAlign.o Repeats.o IndelAllele.o disorder.o -o sw.o -L.
#g++ -O3 -c -o smithwaterman.cpp disorder.o BandedSmithWaterman.o SmithWatermanGotoh.o Repeats.o LeftAlign.o IndelAllele.o -I.
make[4]: Leaving directory '/app/deps/vcflib/smithwaterman'
cd filevercmp && make && cp *.h* /app/deps/vcflib/include/ && cp *.o /app/deps/vcflib/include/
make[4]: Entering directory '/app/deps/vcflib/filevercmp'
make[4]: Nothing to be done for 'all'.
make[4]: Leaving directory '/app/deps/vcflib/filevercmp'
g++ -c -o src/Variant.o src/Variant.cpp -Itabixpp/htslib -Iinclude -L. -Ltabixpp/htslib -Llib -lvcflib -lhts -lpthread -lz -lm -O3 -D_FILE_OFFSET_BITS=64 -std=c++0x  && cp src/*.h* /app/deps/vcflib/include/
g++ -c -o src/rnglib.o src/rnglib.cpp -Itabixpp/htslib -Iinclude -L. -Ltabixpp/htslib -Llib -lvcflib -lhts -lpthread -lz -lm -O3 -D_FILE_OFFSET_BITS=64 -std=c++0x  && cp src/*.h* /app/deps/vcflib/include/
g++ -c -o src/var.o src/var.cpp -Itabixpp/htslib -Iinclude -L. -Ltabixpp/htslib -Llib -lvcflib -lhts -lpthread -lz -lm -O3 -D_FILE_OFFSET_BITS=64 -std=c++0x  && cp src/*.h* /app/deps/vcflib/include/
g++ -c -o src/pdflib.o src/pdflib.cpp -Itabixpp/htslib -Iinclude -L. -Ltabixpp/htslib -Llib -lvcflib -lhts -lpthread -lz -lm -O3 -D_FILE_OFFSET_BITS=64 -std=c++0x  && cp src/*.h* /app/deps/vcflib/include/
g++ -c -o src/cdflib.o src/cdflib.cpp -Itabixpp/htslib -Iinclude -L. -Ltabixpp/htslib -Llib -lvcflib -lhts -lpthread -lz -lm -O3 -D_FILE_OFFSET_BITS=64 -std=c++0x  && cp src/*.h* /app/deps/vcflib/include/
g++ -c -o src/split.o src/split.cpp -Itabixpp/htslib -Iinclude -L. -Ltabixpp/htslib -Llib -lvcflib -lhts -lpthread -lz -lm -O3 -D_FILE_OFFSET_BITS=64 -std=c++0x  && cp src/*.h* /app/deps/vcflib/include/
g++ -O3 -D_FILE_OFFSET_BITS=64 -std=c++0x    -c -o smithwaterman/Repeats.o smithwaterman/Repeats.cpp
cd fastahack && make && cp *.h* /app/deps/vcflib/include/ && cp Fasta.o /app/deps/vcflib/obj/
make[4]: Entering directory '/app/deps/vcflib/fastahack'
make[4]: 'fastahack' is up to date.
make[4]: Leaving directory '/app/deps/vcflib/fastahack'
g++ -O3 -D_FILE_OFFSET_BITS=64 -std=c++0x    -c -o smithwaterman/disorder.o smithwaterman/disorder.cpp
g++ -O3 -D_FILE_OFFSET_BITS=64 -std=c++0x    -c -o smithwaterman/LeftAlign.o smithwaterman/LeftAlign.cpp
g++ -O3 -D_FILE_OFFSET_BITS=64 -std=c++0x    -c -o smithwaterman/IndelAllele.o smithwaterman/IndelAllele.cpp
ar rs libvcflib.a src/Variant.o src/rnglib.o src/var.o src/pdflib.o src/cdflib.o src/split.o smithwaterman/sw.o fastahack/Fasta.o src/ssw.o src/ssw_cpp.o filevercmp/filevercmp.o tabixpp/tabix.o
cp libvcflib.a lib
cd intervaltree && make && cp *.h* /app/deps/vcflib/include/
make[4]: Entering directory '/app/deps/vcflib/intervaltree'
g++ -Wall interval_tree_test.cpp -o interval_tree_test -std=c++0x
make[4]: Leaving directory '/app/deps/vcflib/intervaltree'
g++ src/vcf2tsv.cpp -o bin/vcf2tsv -Itabixpp/htslib -Iinclude -L. -Ltabixpp/htslib -Llib -lvcflib -lhts -lpthread -lz -lm -O3 -D_FILE_OFFSET_BITS=64 -std=c++0x  -DVERSION=\"\"
make[3]: Leaving directory '/app/deps/vcflib'
make[2]: Leaving directory '/app/deps/vcflib'
/app/test
make[2]: Entering directory '/app/deps/fastahack'
g++ -O3 -D_FILE_OFFSET_BITS=64 -c Fasta.cpp
g++ -O3 -D_FILE_OFFSET_BITS=64 Fasta.o FastaHack.cpp split.o disorder.o -o fastahack
make[2]: Leaving directory '/app/deps/fastahack'
/app/test
ok 16 - the graph contains all the sequence in the reference and VCF
ok 17 - varying the max node size does not affect graph length
ok 18 - nodes are correctly capped in size
ok 19 - -R --region flag is respected
ok 20 - vg construct does not require a vcf
ok 21 - vg construct respects node size limit
ok 22 - --region can be interpreted to be a reference sequence (and not parsed as a region spec)
ok
graph invalid: edge index=2 (2->4) cannot find node (to) 4
[vg view] warning: graph is invalid!
graph invalid: edge index=2 (2->4) cannot find node (to) 4
[vg view] warning: graph is invalid!
[bam_header_read] EOF marker is absent. The input is probably truncated.
t/03_vg_view.t ....... 
1..13
ok 1 - view produces the expected number of lines of dot output
ok 2 - view produces the expected number of lines of GFA output
ok 3 - view converts back and forth between GFA and vg format
ok 4 - view can convert BAM to GAM
ok 5 - view can round-trip JSON and GAM
ok 6 - view can reconstruct a VG graph from JSON
ok 7 - view can pass through VG
ok 8 - view parses sample names
ok 9 - view can handle fastq input
ok 10 - view can translate graphs with 2-node cycles
ok 11 - view outputs properly oriented GFA
ok 12 - view produces the expected number of lines of dot output from a cyclic graph
ok 13 - streaming JSON output produces the expected number of chunks
ok
t/04_vg_align.t ...... 
1..13
ok 1 - alignment traverses the correct path
ok 2 - alignment score is as expected
ok 3 - scoring parameters are respected
ok 4 - alignment does not contain excessive soft clips under lenient scoring
ok 5 - alignment score does not overflow at 255 when using 8x16bit vectors
ok 6 - Ns do not cause excessive soft clipping
ok 7 - nodes are only referenced if they have mappings
ok 8 - align can use query names and outputs GAM
ok 9 - alignment to cyclic graphs works
ok 10 - graphs where duplicated nodes need flipping can be used for alignment
ok 11 - node flipping doesn't destroy the alignment
ok 12 - alignment correctly handles an inversion
ok 13 - the exploding graph doesn't blow up
ok
t/05_vg_find.t ....... 
1..31
ok 1 - construction
ok 2 - indexing nodes and edges of graph
ok 3 - indexing 11mers
ok 4 - all expected nodes found via kmer find
ok 5 - all expected edges found via kmer find
ok 6 - multiple nodes can be picked using vg find
ok 7 - vg find returns a correctly-sized graph when seeking a sequence
ok 8 - vg find returns a correctly-sized graph when using jump-kmers
ok 9 - vg find returns a subgraph corresponding to particular reference coordinates
ok 10 - vg find returns a path of the correct length
ok 11 - larger graph is returned when the reference path is queried with context
ok 12 - entire graph is returned when the reference path is queried with context
ok 13 - we can find edges on start
ok 14 - we can find edges on end
ok 15 - a path can be queried from the xg index
ok 16 - a node near another can be obtained using context from the xg index
ok 17 - each perfect read contains one maximal exact match
ok 18 - vg find -D finds distance 0 between 2 adjacent nodes
ok 19 - vg find -D finds distance 0 between node and adjacent snp
ok 20 - vg find -D jumps deletion
ok 21 - vg find -D jumps deletion from snp
ok 22 - vg find -L finds same number of nodes (with -c 1)
ok 23 - vg find -L works with -r 
ok 24 - vg find -L only follows alternating paths
ok 25 - vg find -L tracks length
ok 26 - vg find -L works with more than one input node
ok 27 - we find the 4 canonical SMEMs from @lh3's bwa mem poster
ok 28 - we can find the right MEMs for a sequence with Ns
ok 29 - we find the same MEMs sequences with different lengths of Ns
ok 30 - the index can return the set of alignments mapping to a particular node
ok 31 - the index can be queried using GAM alignments
ok
t/06_vg_index.t: line 8: warning: setlocale: LC_ALL: cannot change locale (en_US.utf8): No such file or directory
terminate called after throwing an instance of 'std::ios_base::failure[abi:cxx11]'
  what():  failed to open bogus123.vg: iostream error
t/06_vg_index.t: line 29:  3541 Aborted                 (core dumped) vg index -s -d x.idx x.vg bogus123.vg
t/06_vg_index.t ...... 
1..40
ok 1 - indexing nodes and edges of graph
ok 2 - building an xg index of the graph
ok 3 - building an xg index using multiple input files
ok 4 - fail with nonexistent file
ok 5 - indexing 11mers
ok 6 - index compaction
ok 7 - building a GCSA2 index
ok 8 - a prebuilt deBruijn graph in GCSA2 format may be used
ok 9 - dumping graph index
ok 10 - correct number of records in graph index
ok 11 - index can store alignments
ok 12 - index can dump alignments
ok 13 - index stores all mappings
ok 14 - storage of multiple graphs in an index succeeds
ok 15 - building a GCSA2 index of two graphs
ok 16 - correct number of elements in path index
ok 17 - path id recorded
ok 18 - path name recorded
ok 19 - end of the second path found correctly
ok 20 - can index backward nodes
r.idx/000007.sst
ok 21 - backward node index contains data
ok 22 - can index kmers for backward nodes
ok 23 - kmers crossing reversing edges are in index
ok 24 - from_start edges in index
ok 25 - to_end edges in index
ok 26 - index can store alignments to backward nodes
ok 27 - index can store a cyclic graph
ok 28 - index can store alignments to cyclic graphs
ok 29 - GCSA2 index works on cyclic graphs with heads and tails
ok 30 - GCSA2 index works on cyclic graphs with no heads or tails
ok 31 - GCSA2 index works on cyclic graphs with self loops
ok 32 - GCSA2 index works on general cyclic graphs
ok 33 - GCSA2 forward-only indexing works on cyclic graphs with no heads or tails
ok 34 - GCSA2 indexing of a tiny graph works
ok 35 - GCSA2 forward-only indexing of a tiny graph works
ok 36 - GCSA2 indexing succeeds on a single-node graph
ok 37 - GCSA2 forward-only indexing succeeds on a single-node graph
ok 38 - GCSA2 indexing succeeds on graph with heads but no tails
ok 39 - GCSA2 forward-only indexing fails due to impossibility on graph with heads but no tails
ok 40 - indexing with allele paths handles combination insert-and-deletes
ok
[vg sim] error: we need an xg index to sample reads from
t/07_vg_map.t: line 111: rs: command not found
t/07_vg_map.t: line 112: rs: command not found
t/07_vg_map.t: line 123: column: command not found
t/07_vg_map.t ........ 
1..31
ok 1 - offset counts unused bases from the start of the node on the forward strand
ok 2 - offset counts unused bases from the start of the node on the reverse strand
ok 3 - global alignment traverses the correct path
ok 4 - alignment score is as expected
ok 5 - scoring parameters are respected
ok 6 - vg map takes -d as input without a variant graph
ok 7 - vg map can align across a SNP
ok 8 - alignment works on a small graph
ok 9 - binary alignment format is equivalent to json version
ok 10 - alignment from BAM correctly handles qualities
ok 11 - banded alignment produces a correct alignment
ok 12 - multiple alignments are returned in descending score order
ok 13 - only a single primary alignment is returned
ok 14 - mapping of BAM file produces expected number of alignments
ok 15 - mapping from a fastq produces the expected number of alignments
ok 16 - allowing secondary alignments with MEM mapping does not change number of primary alignments
ok 17 - vg connects paired-end reads in gam output
ok 18 - mapping to graphs that can't be oriented without swapping edges works correctly
ok 19 - reads multi-map to multiple possible locations
ok 20 - vg map works based on gcsa and xg indexes
ok 21 - mem mapping works
ok 22 - mem threaded mapping works
ok 23 - vg map can build its own in-memory indexes
ok 24 - paired read alignments forced to be consistent have lower score than unrestricted alignments
not ok 25 - paired read alignments forced to be consistent are closer together in node id space than unrestricted alignments
#          got: '0'
#     expected: '1'
ok 26 - only primary alignments have mapping quality scores
ok 27 - unpaired reads produce mapping quality scores
ok 28 - 18
not ok 29 - unnamed test
#          got: '10'
#     expected: 'base quality adjusted alignment produces higher scores if mismatches have low quality'
ok 30 - paired-end reads are pulled to consistent locations at the cost of non-optimal individual alignments
ok 31 - rescue can replace extra multimappings
Failed 2/31 subtests 
t/08_vg_ids.t ........ 
1..8
ok 1 - minimum node as expected (topological sort and id compaction correct)
ok 2 - maximum node is as expected (topological sort and id compaction correct)
ok 3 - correctly generated joint id space for several graphs
ok 4 - can sort and re-number a graph with self loops
ok 5 - can sort and renumber a complex cyclic graph
ok 6 - sorting removes back-edges in a DAG
ok 7 - sorting assigns node IDs in topological order
ok 8 - can handle graphs with out-of-order mappings
ok
t/09_vg_concat.t ..... 
1..1
ok 1 - concat doubles the number of nodes
ok
graph path 's3' invalid: edge from 7 end to 8 start does not exist
[vg view] warning: graph is invalid!
t/10_vg_stats.t ...... 
1..15
ok 1 - vg stats reports the expected number of nodes
ok 2 - vg stats reports the expected number of edges
ok 3 - vg stats reports the expected graph length
ok 4 - vg stats reports the correct number of subgraphs
ok 5 - vg stats reports the correct subgraph length
ok 6 - perfect to and from siblings are determined
ok 7 - distance to head is correct
ok 8 - distance to tail is correct
ok 9 - a superbubble's internal nodes are correctly reported
ok 10 - a cactusbubble's internal nodes are correctly reported
ok 11 - superbubbles are detected even when the graph initially has reversing edges
ok 12 - cactusbubbles are detected even when the graph initially has reversing edges
ok 13 - superbubbles and cactus bubbles identical for 1mb1kgp
ok 14 - superbubbles and cactus bubbles identical for atomized tiny
ok 15 - aligned read stats are computed correctly
ok
t/11_vg_paths.t ...... 
1..1
ok 1 - number of paths as expected for tiny graph
ok
t/12_vg_kmers.t ...... 
1..16
ok 1 - correct numbers of kmers in the graph when reporting only start positions
ok 2 - correct numbers of kmers in the graph when including negative-offset entries
ok 3 - only unique kmers are produced
ok 4 - to_end edges are handled correctly
ok 5 - from_start edges are handled correctly
ok 6 - kmers correctly generated from all nodes
ok 7 - GCSA2 output produces the expected number of lines
ok 8 - GCSA2 binary output produces the expected number bytes
ok 9 - GCSA2 output works when next position is multiple
ok 10 - GCSA2 output works when previous characters are multiple
ok 11 - GCSA2 output correctly represents repeated kmers at the same position
ok 12 - edge-max can limit to paths with exactly one choice from any node's point of view
ok 13 - edge-max correctly bounds the number of kmers in a complex graph
ok 14 - start/stop node IDs can be specified in GCSA2 output
ok 15 - attempting to generate kmers longer than the longest path in a graph correctly yields no kmers
ok 16 - indexing only embedded paths yields the same result as indexing a graph which has been pruned to the path in question
ok
t/13_vg_sim.t ........ 
1..5
ok 1 - vg sim creates the correct number of reads
ok 2 - alignments may be generated rather than read sequences
ok 3 - alignments are produced on both strands
ok 4 - high simulated error rates do not change the number of bases generated
ok 5 - vg sim creates forward-strand reads when asked
ok
terminate called after throwing an instance of 'j2pb_error'
  what():  Unknown field: is_reverse
[VG::normalize] iteration 1 current length 5
[VG::normalize] normalized in 0 steps
[VG::normalize] iteration 1 current length 5
[VG::normalize] normalized in 0 steps
t/14_vg_mod.t ........ 
1..38
ok 1 - vg mod yields a graph with only a particular path
ok 2 - orphan edge removal works
ok 3 - path inclusion does not modify the graph when alignment is a perfect match
ok 4 - path inclusion with a complex variant introduces the right number of nodes
ok 5 - path inclusion works for deletions
ok 6 - SNPs can be included in the graph
ok 7 - graph complexity reduction works as expected
ok 8 - short subgraph pruning works
ok 9 - a soft clip at read start becomes a new head of the graph
ok 10 - a soft clip at read end becomes a new tail of the graph
ok 11 - normalization produces the correct number of nodes
ok 12 - normalization produces a valid graph
ok 13 - unchop produces a valid graph
ok 14 - normalization removes redundant sequence in the graph
ok 15 - normalization doesn't introduce cycles and does remove redundancy in bubbles
ok 16 - vg mod removes non-path nodes and edge
ok 17 - chopping a graph works correctly with reverse mappings
ok 18 - unchop correctly handles paths
ok 19 - unchop correctly handles a graph with an inversion
ok 20 - normalization works on a graph with an inversion
ok 21 - mod successfully unchops a difficult graph
ok 22 - a single path may be retained
ok 23 - path filtering does not modify the graph
ok 24 - chopping self-cycling nodes retains the cycle
ok 25 - unrolling works and produces a valid graph
ok 26 - unfolding works and produces a valid graph
ok 27 - dagify-unroll produces a graph with the same kmers as the original graph
ok 28 - unfold produces a graph with the same kmers as the original graph
ok 29 - dagify handles a graph with two strongly connected components
ok 30 - unfold followed by dagify produces a graph with no cycles
ok 31 - unfold followed by dagify produces a graph with the same kmers as the original graph
ok 32 - dagify unrolls the un-unrollable graph
ok 33 - sibling simplification does not disrupt paths
ok 34 - dagify correctly calculates the minimum distance through the unrolled component
ok 35 - dagify only takes one step past our component length limit
ok 36 - the expected graph translation is exported when the graph is edited
ok 37 - editing the graph with many SNP-containing alignments does not introduce duplicate identical nodes
ok 38 - subsetting a flat-alleles graph to a sample graph works
ok
[bam_header_read] EOF marker is absent. The input is probably truncated.
t/15_vg_surject.t .... 
1..11
ok 1 - vg surject works perfectly for perfect reads derived from the reference
ok 2 - vg surject actually places reads on the correct path
ok 3 - vg surject works for every read simulated from a dense graph
ok 4 - vg surject produces valid SAM output
ok 5 - vg surject retains read names
ok 6 - forward and reverse orientations of a read produce the same surjected SAM, ignoring flags
ok 7 - vg surject produces valid BAM output
ok 8 - surjection works for a longer (151bp) read
ok 9 - surjection works for another difficult read
ok 10 - mapping reproduces qualities from BAM input
ok 11 - mapping reproduces qualities from fastq input
ok
index file msgas/s-rev.fa.fai not found, generating...
index file GRCh38_alts/FASTA/HLA/K-3138.fa.fai not found, generating...
index file GRCh38_alts/FASTA/HLA/B-3106.fa.fai not found, generating...
t/16_vg_msga.t ....... 
1..16
ok 1 - MSGA produces the expected graph for GRCh38 HLA-V
ok 2 - graph for GRCh38 HLA-V is unaffected by the number of alignment threads
ok 3 - varying alignment bandwidth does not affect output graph
ok 4 - banded alignment can detect and include large deletions in the graph
ok 5 - assembly around indels works regardless of the base sequence that is used
ok 6 - soft clips at node boundaries (start) are included correctly
ok 7 - soft clips at node boundaries (end) are included correctly
ok 8 - adding in existing sequences in reverse doesn't change graph
ok 9 - the paths of the graph encode the original sequences used to build it
ok 10 - even when banding the paths of the graph encode the original sequences used to build it
ok 11 - HLA K-3138 correctly includes all input paths
ok 12 - a difficult cyclic path can be included to produce a valid graph
ok 13 - a cyclic path can be normalized
ok 14 - bandwidth does not affect a cyclic graph, meaning normalization is correct
ok 15 - edges in cycles with two nodes are correctly included
ok 16 - HLA B-3106 is assembled into a valid graph
ok
t/17_vg_pileup.t ..... 
1..1
ok 1 - vg pileup produces the expected output for test case on tiny graph.
ok
t/18_vg_call.t ....... 
1..2
ok 1 - vg call -l produces the expected output for toy snp test case.
ok 2 - vg call doesn't crash in multiallelic mode
ok
t/19_vg_compare.t .... 
1..1
ok 1 - vg compare produces the expected output for 6mer comparison test case.
ok
rapper: Parsing file <stdin> with parser turtle and base URI http://example.org/vg
rapper: Parsing returned 85 triples
rapper: Parsing file <stdin> with parser turtle and base URI http://example.org/vg
rapper: Parsing returned 75 triples
t/20_vgtordf.t ....... 
1..7
ok 1 - vg view produces the expected number of lines of turtle
ok 2 - vg view produces the expected number of lines of turtle
ok 3 - rapper passed
ok 4 - rapper passed
ok 5 - vg view produces the expected number of lines of turtle
ok 6 - vg view produces the expected number of lines of turtle
not ok 7 - There are 25 distinct subjects in the tiny.ttl tested with SPARQL
#          got: '0'
#     expected: '1'
Failed 1/7 subtests 
Unable to find region in index: y:1-1
t/21_vg_filter.t ..... 
1..5
ok 1 - vg filter with no options preserves input.
ok 2 - vg filter makes right number of chunks.
ok 3 - vg filter left chunk has all left nodes
ok 4 - vg filter right chunk has no left nodes
ok 5 - vg filter big chunk has everything
ok
t/22_ggsv.t .......... skipped: (no reason given)
t/23_vectorize.t ..... skipped: (no reason given)
t/24_filter.t ........ skipped: (no reason given)
t/25_circularize.t ... 
1..1
ok 1 - a path may be circularized
ok
t/26_deconstruct.t ... 
1..2
ok 1 - vg deconstruct produces the expected number of superbubbles in a simple graph.
ok 2 - vg deconstruct produces the expected superbubble format and the right bubbles on a small graph.
ok
Converted 100 alignments to embedded paths
Statistics:
Number of Non-Degenerate Sites: 4
Sites traversed by reads: 4
Sites on reference: 0
Site length distribution: 
Converted 100 alignments to embedded paths
Traced 50 bp reference path x.
Reference sequence: CAAATAAGGCTTGGAAATTTTCTGGAGTTCTATTATATTCCAACTCTCTG
Warning: dropping locus from VCF due to insufficient per-strand support 0, 1
Warning: dropping locus from VCF due to insufficient per-strand support 2, 1
Warning: dropping locus from VCF due to insufficient per-strand support 2, 1
Statistics:
Number of Non-Degenerate Sites: 4
Sites traversed by reads: 4
Sites on reference: 4
Site length distribution: 
1	3
2	1
index file flat1.fa.fai not found, generating...
index file flat2.fa.fai not found, generating...
Converted 60 alignments to embedded paths
Statistics:
Number of Non-Degenerate Sites: 7
Sites traversed by reads: 7
Sites on reference: 0
Site length distribution: 
index file flats.fa.fai not found, generating...
t/27_vg_genotype.t ... 
1..6
ok 1 - vg genotype runs successfully
ok 2 - vg genotype runs successfully when emitting vcf
ok 3 - vg genotype finds no superbubbles for an empty subset
ok 4 - vg genotype finds few superbubbles for a subset of just the reference
ok 5 - called genotypes are correct in a small simulated example
ok 6 - genotype format can be converted to and from JSON
ok
t/28_translate.t ..... 
1..2
ok 1 - alignments used to modify a graph may be projected back to the original graph and used to regenerate the same graph
ok 2 - translation overlay works and produces a sane result
ok

Test Summary Report
-------------------
t/07_vg_map.t      (Wstat: 0 Tests: 31 Failed: 2)
  Failed tests:  25, 29
t/20_vgtordf.t     (Wstat: 0 Tests: 7 Failed: 1)
  Failed test:  7
Files=29, Tests=290, 447 wallclock secs ( 0.16 usr  0.04 sys + 859.45 cusr 32.36 csys = 892.01 CPU)
Result: FAIL
make[1]: *** [test] Error 1
Makefile:11: recipe for target 'test' failed
make[1]: Leaving directory '/app/test'
make: *** [test] Error 2
Makefile:81: recipe for target 'test' failed
The command '/bin/sh -c make test' returned a non-zero code: 2