- 960 Grid System - An effort to streamline web development workflow by providing commonly used dimensions, based on a width of 960 pixels. There are two variants: 12 and 16 columns, which can be used separately or in tandem.
- Compass - Open source CSS Authoring Framework.
- Bootstrap - Sleek, intuitive, and powerful mobile first front-end framework for faster and easier web development.
- Font Awesome - The iconic font designed for Bootstrap.
- Zurb Foundation - Framework for writing responsive web sites.
- SASS - CSS extension language which allows variables, mixins and rules nesting.
- Skeleton - Boilerplate for responsive, mobile-friendly development.
Przemyslaw Stempor Przemol
Przemol
/ ce11ToCe10.over.chain
Created
January 16, 2018 13:18
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| chain 1420037770 chrI 15072434 + 0 15072434 chrI 15072423 + 0 15072423 5 | |
| 288367 0 1 | |
| 49582 0 1 | |
| 3348 0 1 | |
| 884584 1 0 | |
| 731267 0 1 | |
| 203378 1 0 | |
| 1324625 0 1 | |
| 399852 13 13 | |
| 122370 1 0 |
Przemol
/ ce10ToCe11.over.chain
Created
January 9, 2018 16:46
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| chain 1420038175 chrI 15072423 + 0 15072423 chrI 15072434 + 0 15072434 5 | |
| 288367 1 0 | |
| 49582 1 0 | |
| 3348 1 0 | |
| 884584 0 1 | |
| 731267 1 0 | |
| 203378 0 1 | |
| 1324625 1 0 | |
| 399852 1 1 | |
| 11 1 1 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| test |
Przemol
/ All_piRNAs_new_reference.fasta
Created
February 23, 2017 15:36
This file has been truncated, but you can view the full file.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| >21UR-1662 21U-RNA, 23 reads._IV-5339209_neg_24.739076423 | |
| TACATGAACTACATACTTTAC | |
| >21UR-7584 21U-RNA, 33 reads._IV-4960535_pos_27.7488571426 | |
| TTTAAGGATTGAAGGTATTTT | |
| >21UR-8935 21U-RNA, 14 reads._IV-15301603_neg_16.1996107479 | |
| TTTTCTTTCTAGCTTCAAACA | |
| >21UR-6515 21U-RNA, 75 reads._IV-6094050_pos_26.4378356656 | |
| TCCAATCTTTCAGAACTGAAG | |
| >21UR-3806 21U-RNA, 422 reads._IV-15884376_neg_16.6423085559 | |
| TACTTTTGCAATTCAAAACTG |
Przemol
/ BigWigSummary.R
Last active
February 21, 2017 17:07
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| # devtools::source_gist('8d889e75c6cc80a1b27c147fedf32982', filename='BigWigSummary.R') | |
| BigWigSummary <- function(files, ranges) { | |
| library(rtracklayer) | |
| library(tidyverse) | |
| require(pbmcapply) | |
| out_list <- pbmclapply(files, function(file) { | |
| vc <- mean(import.bw(file, selection=BigWigSelection(ranges), as='RleList')[ranges]) | |
| names(vc) <- NULL |
Przemol
/ CombinedBlacklists.bed
Created
November 10, 2016 16:22
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| chrI 0 1185 . 0 . | |
| chrI 335054 335131 . 0 . | |
| chrI 669610 671617 . 0 . | |
| chrI 779179 779204 . 0 . | |
| chrI 915079 915644 . 0 . | |
| chrI 933000 934897 . 0 . | |
| chrI 1001703 1001977 . 0 . | |
| chrI 1117810 1118060 . 0 . | |
| chrI 1120997 1124105 . 0 . | |
| chrI 2542827 2544080 . 0 . |
Przemol
/ CombinedBlacklists.bed
Created
September 17, 2016 14:20
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| chrI 0 1185 . 0 . | |
| chrI 335054 335131 . 0 . | |
| chrI 669610 671617 . 0 . | |
| chrI 779179 779204 . 0 . | |
| chrI 915079 915644 . 0 . | |
| chrI 933000 934897 . 0 . | |
| chrI 1001703 1001977 . 0 . | |
| chrI 1117810 1118060 . 0 . | |
| chrI 1120997 1124105 . 0 . | |
| chrI 2542827 2544080 . 0 . |
Przemol
/ css_resources.md
Created
August 22, 2014 13:42
— forked from jookyboi/css_resources.md
CSS libraries and guides to bring some order to the chaos.
Przemol
/ python_resources.md
Created
August 22, 2014 13:42
— forked from jookyboi/python_resources.md
Python-related modules and guides.
- lxml - Pythonic binding for the C libraries libxml2 and libxslt.
- boto - Python interface to Amazon Web Services
- Django - Django is a high-level Python Web framework that encourages rapid development and clean, pragmatic design.
- Fabric - Library and command-line tool for streamlining the use of SSH for application deployment or systems administration task.
- PyMongo - Tools for working with MongoDB, and is the recommended way to work with MongoDB from Python.
- Celery - Task queue to distribute work across threads or machines.
- pytz - pytz brings the Olson tz database into Python. This library allows accurate and cross platform timezone calculations using Python 2.4 or higher.
Przemol
/ rails_resources.md
Created
August 22, 2014 13:42
— forked from jookyboi/rails_resources.md
Rails-related Gems and guides to accelerate your web project.
- Bundler - Bundler maintains a consistent environment for ruby applications. It tracks an application's code and the rubygems it needs to run, so that an application will always have the exact gems (and versions) that it needs to run.
- rabl - General ruby templating with json, bson, xml, plist and msgpack support
- Thin - Very fast and lightweight Ruby web server
- Unicorn - Unicorn is an HTTP server for Rack applications designed to only serve fast clients on low-latency, high-bandwidth connections and take advantage of features in Unix/Unix-like kernels.
- SimpleCov - SimpleCov is a code coverage analysis tool for Ruby 1.9.
- Zeus - Zeus preloads your Rails app so that your normal development tasks such as console, server, generate, and specs/tests take less than one second.
- [factory_girl](h
NewerOlder