Skip to content

Instantly share code, notes, and snippets.

View Przemol's full-sized avatar

Przemyslaw Stempor Przemol

  • University of Cambridge
  • Cambridge, UK
View GitHub Profile
@Przemol
Przemol / javascript_resources.md
Created August 22, 2014 13:42 — forked from jookyboi/javascript_resources.md
Here are a set of libraries, plugins and guides which may be useful to your Javascript coding.

Libraries

  • jQuery - The de-facto library for the modern age. It makes things like HTML document traversal and manipulation, event handling, animation, and Ajax much simpler with an easy-to-use API that works across a multitude of browsers.
  • Backbone - Backbone.js gives structure to web applications by providing models with key-value binding and custom events, collections with a rich API of enumerable functions, views with declarative event handling, and connects it all to your existing API over a RESTful JSON interface.
  • AngularJS - Conventions based MVC framework for HTML5 apps.
  • Underscore - Underscore is a utility-belt library for JavaScript that provides a lot of the functional programming support that you would expect in Prototype.js (or Ruby), but without extending any of the built-in JavaScript objects.
  • lawnchair - Key/value store adapter for indexdb, localStorage
@Przemol
Przemol / rails_resources.md
Created August 22, 2014 13:42 — forked from jookyboi/rails_resources.md
Rails-related Gems and guides to accelerate your web project.

Gems

  • Bundler - Bundler maintains a consistent environment for ruby applications. It tracks an application's code and the rubygems it needs to run, so that an application will always have the exact gems (and versions) that it needs to run.
  • rabl - General ruby templating with json, bson, xml, plist and msgpack support
  • Thin - Very fast and lightweight Ruby web server
  • Unicorn - Unicorn is an HTTP server for Rack applications designed to only serve fast clients on low-latency, high-bandwidth connections and take advantage of features in Unix/Unix-like kernels.
  • SimpleCov - SimpleCov is a code coverage analysis tool for Ruby 1.9.
  • Zeus - Zeus preloads your Rails app so that your normal development tasks such as console, server, generate, and specs/tests take less than one second.
  • [factory_girl](h
@Przemol
Przemol / python_resources.md
Created August 22, 2014 13:42 — forked from jookyboi/python_resources.md
Python-related modules and guides.

Packages

  • lxml - Pythonic binding for the C libraries libxml2 and libxslt.
  • boto - Python interface to Amazon Web Services
  • Django - Django is a high-level Python Web framework that encourages rapid development and clean, pragmatic design.
  • Fabric - Library and command-line tool for streamlining the use of SSH for application deployment or systems administration task.
  • PyMongo - Tools for working with MongoDB, and is the recommended way to work with MongoDB from Python.
  • Celery - Task queue to distribute work across threads or machines.
  • pytz - pytz brings the Olson tz database into Python. This library allows accurate and cross platform timezone calculations using Python 2.4 or higher.

Guides

@Przemol
Przemol / css_resources.md
Created August 22, 2014 13:42 — forked from jookyboi/css_resources.md
CSS libraries and guides to bring some order to the chaos.

Libraries

  • 960 Grid System - An effort to streamline web development workflow by providing commonly used dimensions, based on a width of 960 pixels. There are two variants: 12 and 16 columns, which can be used separately or in tandem.
  • Compass - Open source CSS Authoring Framework.
  • Bootstrap - Sleek, intuitive, and powerful mobile first front-end framework for faster and easier web development.
  • Font Awesome - The iconic font designed for Bootstrap.
  • Zurb Foundation - Framework for writing responsive web sites.
  • SASS - CSS extension language which allows variables, mixins and rules nesting.
  • Skeleton - Boilerplate for responsive, mobile-friendly development.

Guides

chrI 0 1185 . 0 .
chrI 335054 335131 . 0 .
chrI 669610 671617 . 0 .
chrI 779179 779204 . 0 .
chrI 915079 915644 . 0 .
chrI 933000 934897 . 0 .
chrI 1001703 1001977 . 0 .
chrI 1117810 1118060 . 0 .
chrI 1120997 1124105 . 0 .
chrI 2542827 2544080 . 0 .
chrI 0 1185 . 0 .
chrI 335054 335131 . 0 .
chrI 669610 671617 . 0 .
chrI 779179 779204 . 0 .
chrI 915079 915644 . 0 .
chrI 933000 934897 . 0 .
chrI 1001703 1001977 . 0 .
chrI 1117810 1118060 . 0 .
chrI 1120997 1124105 . 0 .
chrI 2542827 2544080 . 0 .
# devtools::source_gist('8d889e75c6cc80a1b27c147fedf32982', filename='BigWigSummary.R')
BigWigSummary <- function(files, ranges) {
library(rtracklayer)
library(tidyverse)
require(pbmcapply)
out_list <- pbmclapply(files, function(file) {
vc <- mean(import.bw(file, selection=BigWigSelection(ranges), as='RleList')[ranges])
names(vc) <- NULL
This file has been truncated, but you can view the full file.
>21UR-1662 21U-RNA, 23 reads._IV-5339209_neg_24.739076423
TACATGAACTACATACTTTAC
>21UR-7584 21U-RNA, 33 reads._IV-4960535_pos_27.7488571426
TTTAAGGATTGAAGGTATTTT
>21UR-8935 21U-RNA, 14 reads._IV-15301603_neg_16.1996107479
TTTTCTTTCTAGCTTCAAACA
>21UR-6515 21U-RNA, 75 reads._IV-6094050_pos_26.4378356656
TCCAATCTTTCAGAACTGAAG
>21UR-3806 21U-RNA, 422 reads._IV-15884376_neg_16.6423085559
TACTTTTGCAATTCAAAACTG
test
chain 1420038175 chrI 15072423 + 0 15072423 chrI 15072434 + 0 15072434 5
288367 1 0
49582 1 0
3348 1 0
884584 0 1
731267 1 0
203378 0 1
1324625 1 0
399852 1 1
11 1 1