Skip to content

Instantly share code, notes, and snippets.

Embed
What would you like to do?
>gnl|GNOMON|17969.m Partial model predicted by Gnomon on Acanthaster planci unplaced genomic scaffold, OKI-Apl_1.0 oki_scaffold1752, whole genome shotgun sequence (NW_019093106.1)
AAGCAAAAAGCAGAGAAGGAGAAACCAGGTTTCCTTAGTAGGATCCACCAGGCATTCAGCTTTGAAGAGG
AACAGTCCAGGGATGATGAGCAGGATAGTCAAGACAGCGAGTCCGAGGATGGGAGTATTGACGAAGACCC
TGAGGGCAATGAAAACACGGTGGATCCAATCGACTGTTTGAGTGCCCCACGTGCTGTTGTCACCAAAGAA
GAGCTCATCACTGAGGAG
>gnl|GNOMON|70594930.m Model predicted by Gnomon on Acanthaster planci unplaced genomic scaffold, OKI-Apl_1.0 oki_scaffold1731, whole genome shotgun sequence (NW_019093085.1)
CAAGAACAGTGGATGAAGAAAACAGCAGGCGATAGCAGCGTGGTTGGCGCCTTGCCCCTGGGCTCATCTT
CTAGCATCACTGCCCTGATACGCGAAAGCAGCGTGGTTGGTCCCTTCCTGTGGGCTCATCTTCTGGCATC
ACTGCCCTGATAATGTAAGGCGGTAGCAGCGAGGTTGGTCCCCTGCCTGTGGGCTCATCTTCTGGAATCA
CCACCCT
>gnl|GNOMON|18113.m Partial model predicted by Gnomon on Acanthaster planci unplaced genomic scaffold, OKI-Apl_1.0 oki_scaffold1727, whole genome shotgun sequence (NW_019093081.1)
ATGGATTTCTACCAAGACATACAAAACTGCCAAACGTACGAAGCGCTCAACTTGCTTCTCGAAACCATTG
TACTCAGCGAAGATGAGAGGGCGTACGCTTTTCATAGACTGTGCGAACTGGCTCTGATTCAGGAGGCCGG
TGACGGTCCGGGGGATGAAGAGGAACGAATGGACCCGACTGAAGACGGCGCACCGCACCAGCGAGGGTAC
GGGCACGACAACGATGATCCGTGGGCAGAATTTGAGGAGGATGATCCAGAGGACGAGGGGACGGAAGAGC
TACCGGAGGAGGAAGACGAGGAGAACCAGCCACCGAGGAAAAGGATTCGCGTGGAGAGACCGCAAGATTA
TTACAATATTGTAGACGTTAATGAAAA
>gnl|GNOMON|130719778.m Model predicted by Gnomon on Acanthaster planci unplaced genomic scaffold, OKI-Apl_1.0 oki_scaffold1726, whole genome shotgun sequence (NW_019093080.1)
CCTGAGTTACAACTCCTTCTGTGCCCTTCCGCCATGGAGTTAACTTCCACGCACCTACTATAATCAGCAC
GAAACGCAAGACCATAGCTTAATACTTACAGGGAAGTGGATGATCGTGCTG
>gnl|GNOMON|65528162.m Model predicted by Gnomon on Acanthaster planci unplaced genomic scaffold, OKI-Apl_1.0 oki_scaffold1702, whole genome shotgun sequence (NW_019093056.1)
TATATGCAAACAGTCCACAGACCAGCACCAACTGGCCCTCTGTGATACCTGCAAGAAGCACTACCATCTG
GGCTGTCTGGACCCACCACTGAGCCGAATGCCTAAGAAGACTGCTTTCAGCGGATGGCAGTGCTCTGAGT
GCGTCTCATCTTCCAGTGATACCTCCATGGCTGAGACTGTAGAAGGCGAGGAAGGGGATGAGGCAGGCAG
GCGTAAGCGACGAGTCATCCGAGAACCCAATAAATTCACCCCTCCCGTGGACGGCAAAGGCGGTCAGAA
>gnl|GNOMON|85684402.m Model predicted by Gnomon on Acanthaster planci unplaced genomic scaffold, OKI-Apl_1.0 oki_scaffold1690, whole genome shotgun sequence (NW_019093044.1)
GGAAACTGTTGAAATGGTCCCCACCAGCCTAGCTCTTCTTCTTTCGCTGTTTGGAAGGGAACCTCTTTCA
CAAGGCAGATAGGGAAATATTTTCATTTCCAAGAGAGAGGTAGTCAGTGAGGATCCATCATCACCACGAG
AGGGTTACAATGATAACAGCCCAGATGAAGACATAGAAAATCCACTGGTGACAGGACAAAACCCAACTGT
CTACAAAATT
>gnl|GNOMON|65753714.m Model predicted by Gnomon on Acanthaster planci unplaced genomic scaffold, OKI-Apl_1.0 oki_scaffold1685, whole genome shotgun sequence (NW_019093039.1)
GTACCTATACCCACTAAACCAGTCAAATGCTTTGCAGGAGATTCCATCTCTGAAATGGAGACGATTCTGC
AGAATGCTGTGACCTAGCTGCTGGCATCAGATACTGCATTCAGATCCAACAAGACTGGTATTCTTGTAAG
ATGGGAACTACTACTACGTTGAGAACCTACCAGTCTGTCAGCCAGCCAACCAGGAACTTTACCATCCCCC
AGCCACCTTGTCAGC
>gnl|GNOMON|22673.m Partial model predicted by Gnomon on Acanthaster planci unplaced genomic scaffold, OKI-Apl_1.0 oki_scaffold1684, whole genome shotgun sequence (NW_019093038.1)
TGGGGAGCTTTGCAGGAACAAGCTTTTAGGACGCTGAAAGCGCGACTGGAATCACAACCGATCTTGAATC
TTCCCGATCCGGAGAAACCGTATATCTTAGCCACAGATGCCTCAGATGTAGGAATAGGGGCGGTGCTCAT
GCAAGAGCATGAAGGTGTGAACCATCCGATCAGCTATGCCAGCCGAAAGTTGCTGCCACCATCTCGCCTC
TATAACAAGGGCTTCGATGAGCAGCTCATCGGCAAGACAACAAGCCACAGGTCAAATGCCATAAGAGCGT
ACAAGAGAACCAGCGAGGACGAGAAGCAAGCTGTCAGCGTGGCTTTGTACGGAGAGTTACAGCAGG
>gnl|GNOMON|11409.m Partial model predicted by Gnomon on Acanthaster planci unplaced genomic scaffold, OKI-Apl_1.0 oki_scaffold1657, whole genome shotgun sequence (NW_019093011.1)
AAATTCAATAAAACAATTTTTCTAAAAGAAGGCTATTCAGTGAAAATGGCTTTGTGGTGTGATTACCTAT
GCATAGAATGTGCTCGAGATGAAGACCTGGAGAGTCTACCCAGCCACGAGGAAGAGCTTCAAGATGTTGG
GCAGCAACAGCAGCAAATGGATAACACACACATTGACCTTGTCACCCCAGAGCTGAGTGCCGAGGAAAAG
GAATCCATGCCCATGCCTCCGAGACTGTCTCACAAGAAGTCCCTCAAGAAGAAAAGTCCATCGGCTGAGC
ACAGCAGAAAAAGTGGCAGGAAGCTGGATTACCAGAGCTCTAACCAAG
>gnl|GNOMON|22945.m Partial model predicted by Gnomon on Acanthaster planci unplaced genomic scaffold, OKI-Apl_1.0 oki_scaffold1640, whole genome shotgun sequence (NW_019092994.1)
ATCTGCGCCCGCGGCGGCTGCACGCGGCCTCGCGGCCGGCGCTTCGACGTGCACCGGGGCGGCCCTCCTA
CTCGTTGGGGCGCACCACCCGGGCGGCGGTCCCACTCTTTCTCTGCCCCGACGGCCGGGTGTGGGCGGCA
CGCTCAGCGCCGTCCATTTTCAGGGCTAGTTGATTCGGCAGGCTCCATCTATCCTGAGGGAAACTTCGGA
GGGAACCAGCTACTAGACGGTTCGAATAGTCTTTCGCCCCTATACCCAAGTCGGTTTGCAG
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment