Last active
January 10, 2019 16:31
-
-
Save afrendeiro/47fe73064611bc977271a6f529f33e26 to your computer and use it in GitHub Desktop.
pybedtools error related to pybedtools#147
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
>chr1 | |
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC | |
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
import pybedtools | |
fasta = "fasta.fa" | |
bed_file = "regions.bed" | |
bed = pybedtools.BedTool(bed_file) | |
bed.nucleotide_content(fi=fasta) |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
bedtools nuc -fi fasta.fa -bed regions.bed |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
chr1 1 10 |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment