Skip to content

Instantly share code, notes, and snippets.

@afrendeiro

afrendeiro/fasta.fa

Last active Jan 10, 2019
Embed
What would you like to do?
pybedtools error related to pybedtools#147
>chr1
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC
import pybedtools
fasta = "fasta.fa"
bed_file = "regions.bed"
bed = pybedtools.BedTool(bed_file)
bed.nucleotide_content(fi=fasta)
bedtools nuc -fi fasta.fa -bed regions.bed
chr1 1 10
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment