Skip to content

Instantly share code, notes, and snippets.

@afrendeiro
Last active January 10, 2019 16:31
Show Gist options
  • Star 0 You must be signed in to star a gist
  • Fork 0 You must be signed in to fork a gist
  • Save afrendeiro/47fe73064611bc977271a6f529f33e26 to your computer and use it in GitHub Desktop.
Save afrendeiro/47fe73064611bc977271a6f529f33e26 to your computer and use it in GitHub Desktop.
pybedtools error related to pybedtools#147
>chr1
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC
import pybedtools
fasta = "fasta.fa"
bed_file = "regions.bed"
bed = pybedtools.BedTool(bed_file)
bed.nucleotide_content(fi=fasta)
bedtools nuc -fi fasta.fa -bed regions.bed
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment