This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/usr/bin/perl | |
use strict; | |
use Time::HiRes; | |
my $rat = shift @ARGV; | |
my $dir = shift @ARGV; | |
$rat ||= 1; | |
-d $dir or die "$0 <ratio> <dir>"; | |
my @files = `find $dir -type f`; |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
<?php | |
/** | |
* Plugin Name: Elegant Tweaks Portfolio Posts | |
* Plugin URI: http://shop.eleganttweaks.com/divi/posts-plugin/ | |
* Description: Divi posts display same as project posts | |
* Version: 1.02 | |
* Author: Brad Crawford | |
* Author URI: http://www.eleganttweaks.com | |
**/ |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
+-----------------------------------------------------------------------------+ | |
| NVIDIA-SMI 375.66 Driver Version: 375.66 | | |
|-------------------------------+----------------------+----------------------+ | |
| GPU Name Persistence-M| Bus-Id Disp.A | Volatile Uncorr. ECC | | |
| Fan Temp Perf Pwr:Usage/Cap| Memory-Usage | GPU-Util Compute M. | | |
|===============================+======================+======================| | |
| 0 Tesla K80 Off | 0000:00:04.0 Off | 0 | | |
| N/A 33C P8 29W / 149W | 0MiB / 11439MiB | 0% Default | | |
+-------------------------------+----------------------+----------------------+ | |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
nvidia-docker-plugin | 2017/06/07 01:05:05 Loading NVIDIA unified memory | |
nvidia-docker-plugin | 2017/06/07 01:05:05 Loading NVIDIA management library | |
nvidia-docker-plugin | 2017/06/07 01:05:08 Discovering GPU devices | |
nvidia-docker-plugin | 2017/06/07 01:05:08 Provisioning volumes at /var/lib/nvidia-docker/volumes | |
nvidia-docker-plugin | 2017/06/07 01:05:08 Serving plugin API at /run/docker/plugins | |
nvidia-docker-plugin | 2017/06/07 01:05:08 Serving remote API at localhost:3476 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/bin/bash | |
echo "Checking for CUDA and installing." | |
# Check for CUDA and try to install. | |
if ! dpkg-query -W cuda; then | |
# The 16.04 installer works with 16.10. | |
curl -O http://developer.download.nvidia.com/compute/cuda/repos/ubuntu1604/x86_64/cuda-repo-ubuntu1604_8.0.61-1_amd64.deb | |
dpkg -i ./cuda-repo-ubuntu1604_8.0.61-1_amd64.deb | |
apt-get update | |
apt-get install cuda -y | |
fi |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#/bin/bash | |
# install packages to allow apt to use a repository over HTTPS: | |
sudo apt-get -y install \ | |
apt-transport-https ca-certificates curl software-properties-common | |
# add Docker’s official GPG key: | |
curl -fsSL https://download.docker.com/linux/ubuntu/gpg | sudo apt-key add - | |
# set up the Docker stable repository. | |
sudo add-apt-repository \ | |
"deb [arch=amd64] https://download.docker.com/linux/ubuntu \ | |
$(lsb_release -cs) \ |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/usr/bin/perl | |
use strict; | |
my $http_base = shift; | |
my $path_base = shift; | |
my $prev_file = shift; | |
if ( ! $http_base || ! $path_base ) { | |
print STDERR <<"HERE"; | |
USAGE: |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
var jq = document.createElement('script'); | |
jq.src = "https://ajax.googleapis.com/ajax/libs/jquery/2.1.4/jquery.min.js"; | |
document.getElementsByTagName('head')[0].appendChild(jq); | |
// ... give time for script to load, then type (or see below for non wait option) | |
jQuery.noConflict(); |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#Startup script for running bwa-http-docker container as a Google Compute Engine Instance Template. | |
DOCKER_IMAGE=`wget --header 'Metadata-Flavor: Google' -O - -q 'http://metadata.google.internal/computeMetadata/v1/instance/attributes/DOCKER_IMAGE'` | |
BWA_FILES=`wget --header 'Metadata-Flavor: Google' -O - -q 'http://metadata.google.internal/computeMetadata/v1/instance/attributes/BWA_FILES'` | |
apt-get update && apt-get -y install docker.io | |
gcloud docker -- pull $DOCKER_IMAGE | |
docker run -P -e BWA_FILES=$BWA_FILES $DOCKER_IMAGE |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
# create a fastq file | |
user@host:/home/user# echo "@id | |
AGCTTTTCTATAAAATTTAACTTACATTTTTGATATCTAATAATTGATCTACTCAAGTTA | |
+ | |
EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE" > /tmp/my.fq | |
# POST that file to the webserver | |
user@host:/home/user# curl --form database=human.fasta --form fastq=@/tmp/my.fq http://10.142.0.2/cgi-bin/bwa.cgi | |
# response will look something like this | |
# [...] | |
@PG ID:bwa PN:bwa VN:0.7.10-r789 CL:bwa mem /data/human.fasta /tmp/Nc22LIRneb.fq |