public
anonymous / gist:1248342
Created

  • Download Gist
gistfile1.txt
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584
BLASTN 2.2.25+
 
 
Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.
 
 
 
Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
14,049,258 sequences; 36,075,095,184 total letters
 
 
 
Query= GFAVMM201BADC0
 
Length=477
Score E
Sequences producing significant alignments: (Bits) Value
 
gi|194750627|ref|XM_001957596.1| Drosophila ananassae GF23929 (D... 42.8 2.1
gi|118568029|gb|CP000325.1| Mycobacterium ulcerans Agy99, comple... 42.8 2.1
gi|24395301|emb|AL928579.6| Mouse DNA sequence from clone RP23-3... 42.8 2.1
gi|326411376|gb|CP002568.1| Polymorphum gilvum SL003B-26A1, comp... 41.0 7.4
gi|317165637|gb|CP002447.1| Mesorhizobium ciceri biovar biserrul... 41.0 7.4
gi|312283773|gb|AC243242.1| Panicum virgatum clone PV_ABa051-K05... 41.0 7.4
gi|303315262|ref|XM_003067593.1| Coccidioides posadasii C735 del... 41.0 7.4
gi|297153409|gb|CP002047.1| Streptomyces bingchenggensis BCW-1, ... 41.0 7.4
gi|295434944|gb|CP002013.1| Burkholderia sp. CCGE1002 chromosome... 41.0 7.4
gi|283945692|gb|CP001854.1| Conexibacter woesei DSM 14684, compl... 41.0 7.4
gi|194346582|gb|CP001111.1| Stenotrophomonas maltophilia R551-3,... 41.0 7.4
gi|166857509|gb|CP000926.1| Pseudomonas putida GB-1, complete ge... 41.0 7.4
gi|148498119|gb|CP000699.1| Sphingomonas wittichii RW1, complete... 41.0 7.4
 
 
>gi|194750627|ref|XM_001957596.1| Drosophila ananassae GF23929 (Dana\GF23929), mRNA
Length=1641
 
Score = 42.8 bits (46), Expect = 2.1
Identities = 37/45 (83%), Gaps = 1/45 (2%)
Strand=Plus/Plus
 
Query 236 ACGCCGACGACAAGCGGCGAGTCCCTTGTGGACGATCTCGGCCAC 280
|||||||||||||| ||||||||| || |||| |||| ||||
Sbjct 137 ACGCCGACGACAAG-GGCGAGTCCATTTGGGACTTTCTCACCCAC 180
 
 
>gi|118568029|gb|CP000325.1| Mycobacterium ulcerans Agy99, complete genome
Length=5631606
 
Score = 42.8 bits (46), Expect = 2.1
Identities = 36/43 (84%), Gaps = 1/43 (2%)
Strand=Plus/Minus
 
Query 69 CCATGACTGCCGGCAGAACATCGACCGGCCAG-TATGTCGGCC 110
||||| ||||||||||||| |||| || || | |||| |||||
Sbjct 890715 CCATGTCTGCCGGCAGAACTTCGAGCGACCCGATATGGCGGCC 890673
 
 
>gi|24395301|emb|AL928579.6| Mouse DNA sequence from clone RP23-302M15 on chromosome 4, complete
sequence
Length=184057
 
Score = 42.8 bits (46), Expect = 2.1
Identities = 31/35 (89%), Gaps = 1/35 (2%)
Strand=Plus/Plus
 
Query 437 AGCTGCAACATGAATGTGCTCGCAGATCTTCAGGA 471
|||||||||||| ||||||| ||||| |||| |||
Sbjct 146437 AGCTGCAACATGGATGTGCTAGCAGA-CTTCTGGA 146470
 
 
>gi|326411376|gb|CP002568.1| Polymorphum gilvum SL003B-26A1, complete genome
Length=4649365
 
Score = 41.0 bits (44), Expect = 7.4
Identities = 33/40 (83%), Gaps = 0/40 (0%)
Strand=Plus/Plus
 
Query 238 GCCGACGACAAGCGGCGAGTCCCTTGTGGACGATCTCGGC 277
||||||||| ||||||||||| | ||| |||| |||||
Sbjct 2023755 GCCGACGACGCGCGGCGAGTCCGTGGTGCTCGATGTCGGC 2023794
 
 
>gi|317165637|gb|CP002447.1| Mesorhizobium ciceri biovar biserrulae WSM1271, complete genome
Length=6264489
 
Score = 41.0 bits (44), Expect = 7.4
Identities = 22/22 (100%), Gaps = 0/22 (0%)
Strand=Plus/Plus
 
Query 300 TTGATGCCGAGGCGGATGCCAT 321
||||||||||||||||||||||
Sbjct 4510008 TTGATGCCGAGGCGGATGCCAT 4510029
 
 
>gi|312283773|gb|AC243242.1| Panicum virgatum clone PV_ABa051-K05, complete sequence
Length=161398
 
Score = 41.0 bits (44), Expect = 7.4
Identities = 28/32 (88%), Gaps = 0/32 (0%)
Strand=Plus/Plus
 
Query 271 TCTCGGCCACCTGTTTGAGTGGTATTCTTTTG 302
||| |||||||||||||||| ||||| || ||
Sbjct 137850 TCTTGGCCACCTGTTTGAGTTGTATTTTTCTG 137881
 
 
>gi|303315262|ref|XM_003067593.1| Coccidioides posadasii C735 delta SOWgp Sugar transporter family
protein, mRNA
Length=1947
 
Score = 41.0 bits (44), Expect = 7.4
Identities = 31/37 (84%), Gaps = 0/37 (0%)
Strand=Plus/Minus
 
Query 289 GTGGTATTCTTTTGATGCCGAGGCGGATGCCATTGCA 325
||||| ||| | ||||||||||||| | ||| |||||
Sbjct 84 GTGGTCTTCATATGATGCCGAGGCGTAAGCCTTTGCA 48
 
 
>gi|297153409|gb|CP002047.1| Streptomyces bingchenggensis BCW-1, complete genome
Length=11936683
 
Score = 41.0 bits (44), Expect = 7.4
Identities = 27/30 (90%), Gaps = 0/30 (0%)
Strand=Plus/Plus
 
Query 38 GTCGGCAGCGGATCTCCGAAAACCATCAAG 67
|||||||||||| ||||||| ||||||||
Sbjct 3073377 GTCGGCAGCGGAACTCCGAATTCCATCAAG 3073406
 
 
>gi|295434944|gb|CP002013.1| Burkholderia sp. CCGE1002 chromosome 1, complete sequence
Length=3518940
 
Score = 41.0 bits (44), Expect = 7.4
Identities = 33/40 (83%), Gaps = 0/40 (0%)
Strand=Plus/Minus
 
Query 212 ATGGGCGAATCGATCACCTTCAACACGCCGACGACAAGCG 251
|| |||||||||||| | |||||||||| | ||| ||||
Sbjct 2243828 ATCGGCGAATCGATCGCGTTCAACACGCTGGCGATGAGCG 2243789
 
 
>gi|283945692|gb|CP001854.1| Conexibacter woesei DSM 14684, complete genome
Length=6359369
 
Score = 41.0 bits (44), Expect = 7.4
Identities = 35/43 (82%), Gaps = 3/43 (6%)
Strand=Plus/Minus
 
Query 101 TATGTCGGCCATGGCTTCTACAGTCCGGACATGATCGACGGCG 143
||||||||||| | ||||||| ||| || || |||||||||
Sbjct 2039361 TATGTCGGCCACGACTTCTAC---CCGAACCTGGTCGACGGCG 2039322
 
 
>gi|194346582|gb|CP001111.1| Stenotrophomonas maltophilia R551-3, complete genome
Length=4573969
 
Score = 41.0 bits (44), Expect = 7.4
Identities = 32/36 (89%), Gaps = 2/36 (5%)
Strand=Plus/Minus
 
Query 102 ATGTCGGCCATGGC-TTCTACAGTCCGGACATGATC 136
|||||||||||||| || |||| ||||||||||||
Sbjct 3897524 ATGTCGGCCATGGCGTTGCACAG-CCGGACATGATC 3897490
 
 
>gi|166857509|gb|CP000926.1| Pseudomonas putida GB-1, complete genome
Length=6078430
 
Score = 41.0 bits (44), Expect = 7.4
Identities = 35/41 (86%), Gaps = 2/41 (4%)
Strand=Plus/Minus
 
Query 222 CGATCACCTTCAACACG-CCGACGACAAGCGGCGAGTCCCT 261
||||||||||| ||||| ||||||| ||||| | |||| ||
Sbjct 5087565 CGATCACCTTCGACACGTCCGACGA-AAGCGCCAAGTCGCT 5087526
 
 
>gi|148498119|gb|CP000699.1| Sphingomonas wittichii RW1, complete genome
Length=5382261
 
Score = 41.0 bits (44), Expect = 7.4
Identities = 32/38 (85%), Gaps = 3/38 (7%)
Strand=Plus/Plus
 
Query 208 GACGATG---GGCGAATCGATCACCTTCAACACGCCGA 242
||||||| |||| |||||||||||||| |||||||
Sbjct 4265124 GACGATGTGGGGCGGCTCGATCACCTTCAAGACGCCGA 4265161
 
 
 
Lambda K H
0.634 0.408 0.912
 
Gapped
Lambda K H
0.625 0.410 0.780
 
Effective search space used: 15727850050068
 
 
Query= GFAVMM201A1JOH
 
Length=57
Score E
Sequences producing significant alignments: (Bits) Value
 
gi|22416007|emb|AL772315.4| Mouse DNA sequence from clone RP23-5... 41.0 0.42
gi|117168385|gb|AC190175.4| Pan troglodytes BAC clone CH251-542A... 39.2 1.5
gi|45238691|gb|AC145377.2| Pan troglodytes BAC clone RP43-11P19 ... 39.2 1.5
gi|4926907|gb|AC004936.2| Homo sapiens PAC clone RP5-959C21 from... 39.2 1.5
gi|31414500|emb|AL831797.4| Oryza sativa chromosome 12, . BAC OS... 39.2 1.5
gi|158967071|gb|CP000033.3| Lactobacillus acidophilus NCFM, comp... 37.4 5.1
 
 
>gi|22416007|emb|AL772315.4| Mouse DNA sequence from clone RP23-54A13 on chromosome 4, complete
sequence
Length=200266
 
Score = 41.0 bits (44), Expect = 0.42
Identities = 28/31 (91%), Gaps = 2/31 (6%)
Strand=Plus/Minus
 
Query 6 CGTTCCAGTCACGATACATACCAATAACGAC 36
||||||||| | ||||||||||||||||||
Sbjct 26821 CGTTCCAGTGA--ATACATACCAATAACGAC 26793
 
 
>gi|117168385|gb|AC190175.4| Pan troglodytes BAC clone CH251-542A7 from chromosome 7, complete
sequence
Length=214222
 
Score = 39.2 bits (42), Expect = 1.5
Identities = 26/29 (90%), Gaps = 0/29 (0%)
Strand=Plus/Minus
 
Query 19 ATACATACCAATAACGACTTCTATATGTA 47
|||||||||||||| | |||||||||||
Sbjct 166678 ATACATACCAATAAATATTTCTATATGTA 166650
 
 
>gi|45238691|gb|AC145377.2| Pan troglodytes BAC clone RP43-11P19 from chromosome 7, complete
sequence
Length=194463
 
Score = 39.2 bits (42), Expect = 1.5
Identities = 26/29 (90%), Gaps = 0/29 (0%)
Strand=Plus/Plus
 
Query 19 ATACATACCAATAACGACTTCTATATGTA 47
|||||||||||||| | |||||||||||
Sbjct 192749 ATACATACCAATAAATATTTCTATATGTA 192777
 
 
>gi|4926907|gb|AC004936.2| Homo sapiens PAC clone RP5-959C21 from 7, complete sequence
Length=139949
 
Score = 39.2 bits (42), Expect = 1.5
Identities = 26/29 (90%), Gaps = 0/29 (0%)
Strand=Plus/Minus
 
Query 19 ATACATACCAATAACGACTTCTATATGTA 47
|||||||||||||| | |||||||||||
Sbjct 12654 ATACATACCAATAAATATTTCTATATGTA 12626
 
 
>gi|31414500|emb|AL831797.4| Oryza sativa chromosome 12, . BAC OSJNBa0010M16 of library OSJNBa
from chromosome 12 of cultivar Nipponbare of ssp. japonica
of Oryza sativa (rice), complete sequence
Length=132741
 
Score = 39.2 bits (42), Expect = 1.5
Identities = 23/24 (96%), Gaps = 0/24 (0%)
Strand=Plus/Plus
 
Query 18 GATACATACCAATAACGACTTCTA 41
||||||||||||||| ||||||||
Sbjct 126346 GATACATACCAATAAAGACTTCTA 126369
 
 
>gi|158967071|gb|CP000033.3| Lactobacillus acidophilus NCFM, complete genome
Length=1993560
 
Score = 37.4 bits (40), Expect = 5.1
Identities = 20/20 (100%), Gaps = 0/20 (0%)
Strand=Plus/Minus
 
Query 14 TCACGATACATACCAATAAC 33
||||||||||||||||||||
Sbjct 756012 TCACGATACATACCAATAAC 755993
 
 
 
Lambda K H
0.634 0.408 0.912
 
Gapped
Lambda K H
0.625 0.410 0.780
 
Effective search space used: 890637973200
 
 
Query= GFAVMM201D933Z
 
Length=119
Score E
Sequences producing significant alignments: (Bits) Value
 
gi|332189094|gb|CP002684.1| Arabidopsis thaliana chromosome 1, c... 41.0 1.4
gi|313747610|gb|AC237431.3| Macaca mulatta Y Chr BAC RMAEX-106G5... 41.0 1.4
gi|168693784|gb|AC213321.3| MACACA MULATTA BAC clone CH250-541A1... 41.0 1.4
gi|8778954|gb|AC007932.3|F11A17 Arabidopsis thaliana chromosome ... 41.0 1.4
gi|256052438|ref|XM_002569731.1| Schistosoma mansoni GTP-binding... 39.2 5.0
gi|238867551|gb|CP001600.1| Edwardsiella ictaluri 93-146, comple... 39.2 5.0
gi|224465197|ref|NG_009929.1| Homo sapiens like-glycosyltransfer... 39.2 5.0
gi|147784643|emb|AM469007.2| Vitis vinifera contig VV78X098884.1... 39.2 5.0
gi|123663234|emb|AM455601.1| Vitis vinifera, whole genome shotgu... 39.2 5.0
gi|118344518|gb|AC192748.2| Gallus gallus BAC clone CH261-166H21... 39.2 5.0
gi|90309320|gb|AY607844.2| Edwardsiella ictaluri transposase-lik... 39.2 5.0
gi|55908997|gb|AC102414.8| Mus musculus chromosome 15, clone RP2... 39.2 5.0
gi|72096292|gb|AC162857.5| Mus musculus chromosome 15, clone RP2... 39.2 5.0
gi|22415845|emb|AL139016.8| Human DNA sequence from clone RP4-65... 39.2 5.0
gi|6572307|emb|Z82173.2| Human DNA sequence from clone SC22CB-1D... 39.2 5.0
gi|56410822|gb|AC140454.4| Mus musculus BAC clone RP24-163I14 fr... 39.2 5.0
gi|38707373|emb|BX255930.3| Zebrafish DNA sequence from clone DK... 39.2 5.0
 
 
>gi|332189094|gb|CP002684.1| Arabidopsis thaliana chromosome 1, complete sequence
Length=30427671
 
Score = 41.0 bits (44), Expect = 1.4
Identities = 25/27 (93%), Gaps = 0/27 (0%)
Strand=Plus/Minus
 
Query 70 AACAGAAACCACTACGAAAGGAAAGAA 96
||||||||| ||||||||||||||||
Sbjct 17871124 AACAGAAACTTCTACGAAAGGAAAGAA 17871098
 
 
>gi|313747610|gb|AC237431.3| Macaca mulatta Y Chr BAC RMAEX-106G5 complete sequence
Length=169910
 
Score = 41.0 bits (44), Expect = 1.4
Identities = 28/31 (91%), Gaps = 2/31 (6%)
Strand=Plus/Minus
 
Query 75 AAACCACTACGAAAGGAAAGAAATGCCTCTA 105
|||||| ||||||||||| |||||||||||
Sbjct 60448 AAACCA--ACGAAAGGAAATAAATGCCTCTA 60420
 
 
>gi|168693784|gb|AC213321.3| MACACA MULATTA BAC clone CH250-541A11 from chromosome y, complete
sequence
Length=156689
 
Score = 41.0 bits (44), Expect = 1.4
Identities = 28/31 (91%), Gaps = 2/31 (6%)
Strand=Plus/Plus
 
Query 75 AAACCACTACGAAAGGAAAGAAATGCCTCTA 105
|||||| ||||||||||| |||||||||||
Sbjct 62327 AAACCA--ACGAAAGGAAATAAATGCCTCTA 62355
 
 
>gi|8778954|gb|AC007932.3|F11A17 Arabidopsis thaliana chromosome 1 BAC F11A17 sequence, complete
sequence
Length=102078
 
Score = 41.0 bits (44), Expect = 1.4
Identities = 25/27 (93%), Gaps = 0/27 (0%)
Strand=Plus/Plus
 
Query 70 AACAGAAACCACTACGAAAGGAAAGAA 96
||||||||| ||||||||||||||||
Sbjct 32940 AACAGAAACTTCTACGAAAGGAAAGAA 32966
 
 
>gi|256052438|ref|XM_002569731.1| Schistosoma mansoni GTP-binding protein era, putative (Smp_164220)
mRNA, complete cds
Length=1341
 
Score = 39.2 bits (42), Expect = 5.0
Identities = 21/21 (100%), Gaps = 0/21 (0%)
Strand=Plus/Minus
 
Query 40 TTCTCTTTTCGTATTTGGAAC 60
|||||||||||||||||||||
Sbjct 159 TTCTCTTTTCGTATTTGGAAC 139
 
 
>gi|238867551|gb|CP001600.1| Edwardsiella ictaluri 93-146, complete genome
Length=3812315
 
Score = 39.2 bits (42), Expect = 5.0
Identities = 31/37 (84%), Gaps = 3/37 (8%)
Strand=Plus/Plus
 
Query 58 AACAGCTGTTATA---ACAGAAACCACTACGAAAGGA 91
|||||| |||||| ||| ||||||||||| |||||
Sbjct 1978968 AACAGCCGTTATATCCACATAAACCACTACGCAAGGA 1979004
 
 
>gi|224465197|ref|NG_009929.1| Homo sapiens like-glycosyltransferase (LARGE), RefSeqGene on
chromosome 22
Length=654355
 
Score = 39.2 bits (42), Expect = 5.0
Identities = 30/36 (84%), Gaps = 0/36 (0%)
Strand=Plus/Plus
 
Query 66 TTATAACAGAAACCACTACGAAAGGAAAGAAATGCC 101
||| ||||||||||| || |||||||| ||| |||
Sbjct 603836 TTAAAACAGAAACCAAAACCAAAGGAAAAAAAAGCC 603871
 
 
>gi|147784643|emb|AM469007.2| Vitis vinifera contig VV78X098884.11, whole genome shotgun sequence
Length=7756
 
Score = 39.2 bits (42), Expect = 5.0
Identities = 24/26 (93%), Gaps = 0/26 (0%)
Strand=Plus/Minus
 
Query 71 ACAGAAACCACTACGAAAGGAAAGAA 96
||| |||||||||| |||||||||||
Sbjct 6827 ACAAAAACCACTACAAAAGGAAAGAA 6802
 
 
>gi|123663234|emb|AM455601.1| Vitis vinifera, whole genome shotgun sequence, contig VV78X123660.5,
clone ENTAV 115
Length=34741
 
Score = 39.2 bits (42), Expect = 5.0
Identities = 24/26 (93%), Gaps = 0/26 (0%)
Strand=Plus/Plus
 
Query 71 ACAGAAACCACTACGAAAGGAAAGAA 96
||| |||||||||| |||||||||||
Sbjct 34120 ACAAAAACCACTACAAAAGGAAAGAA 34145
 
 
>gi|118344518|gb|AC192748.2| Gallus gallus BAC clone CH261-166H21 from chromosome z, complete
sequence
Length=226699
 
Score = 39.2 bits (42), Expect = 5.0
Identities = 27/31 (88%), Gaps = 0/31 (0%)
Strand=Plus/Plus
 
Query 58 AACAGCTGTTATAACAGAAACCACTACGAAA 88
||||||||| |||||||||||| || ||||
Sbjct 178051 AACAGCTGTCATAACAGAAACCCATATGAAA 178081
 
 
>gi|90309320|gb|AY607844.2| Edwardsiella ictaluri transposase-like protein gene, complete
cds; urease operon, complete sequence; and ammonium transporter
(amtB) and TnpA (tnpA) genes, complete cds
Length=11426
 
Score = 39.2 bits (42), Expect = 5.0
Identities = 31/37 (84%), Gaps = 3/37 (8%)
Strand=Plus/Minus
 
Query 58 AACAGCTGTTATA---ACAGAAACCACTACGAAAGGA 91
|||||| |||||| ||| ||||||||||| |||||
Sbjct 8030 AACAGCCGTTATATCCACATAAACCACTACGCAAGGA 7994
 
 
>gi|55908997|gb|AC102414.8| Mus musculus chromosome 15, clone RP24-474D5, complete sequence
Length=159739
 
Score = 39.2 bits (42), Expect = 5.0
Identities = 24/26 (93%), Gaps = 0/26 (0%)
Strand=Plus/Plus
 
Query 70 AACAGAAACCACTACGAAAGGAAAGA 95
||||||||||||||| |||||| |||
Sbjct 71851 AACAGAAACCACTACAAAAGGAGAGA 71876
 
 
>gi|72096292|gb|AC162857.5| Mus musculus chromosome 15, clone RP23-333C11, complete sequence
Length=224913
 
Score = 39.2 bits (42), Expect = 5.0
Identities = 24/26 (93%), Gaps = 0/26 (0%)
Strand=Plus/Minus
 
Query 70 AACAGAAACCACTACGAAAGGAAAGA 95
||||||||||||||| |||||| |||
Sbjct 3370 AACAGAAACCACTACAAAAGGAGAGA 3345
 
 
>gi|22415845|emb|AL139016.8| Human DNA sequence from clone RP4-658C17 on chromosome 1p11.1-13.3,
complete sequence
Length=100643
 
Score = 39.2 bits (42), Expect = 5.0
Identities = 22/23 (96%), Gaps = 0/23 (0%)
Strand=Plus/Plus
 
Query 87 AAGGAAAGAAATGCCTCTANAAG 109
||||||||||||||||||| |||
Sbjct 22086 AAGGAAAGAAATGCCTCTAGAAG 22108
 
 
>gi|6572307|emb|Z82173.2| Human DNA sequence from clone SC22CB-1D7 on chromosome 22 Contains
a novel gene and part of the LARGE gene for like-glycosyltransferase,
complete sequence
Length=37731
 
Score = 39.2 bits (42), Expect = 5.0
Identities = 30/36 (84%), Gaps = 0/36 (0%)
Strand=Plus/Minus
 
Query 66 TTATAACAGAAACCACTACGAAAGGAAAGAAATGCC 101
||| ||||||||||| || |||||||| ||| |||
Sbjct 15530 TTAAAACAGAAACCAAAACCAAAGGAAAAAAAAGCC 15495
 
 
>gi|56410822|gb|AC140454.4| Mus musculus BAC clone RP24-163I14 from 1, complete sequence
Length=171533
 
Score = 39.2 bits (42), Expect = 5.0
Identities = 28/32 (88%), Gaps = 4/32 (12%)
Strand=Plus/Plus
 
Query 66 TTATAACAGAAACCACTACGAAAGGAAAGAAA 97
|||||||||||||||| ||||||||||||
Sbjct 140248 TTATAACAGAAACCAC----AAAGGAAAGAAA 140275
 
 
>gi|38707373|emb|BX255930.3| Zebrafish DNA sequence from clone DKEY-101K6 in linkage group
9 Contains the 3' end of the mcm3ap gene for MCM3 minichromosome
maintenance deficient 3 (S. cerevisiae) associated protein,
the gene for a novel protein similar to vertebrate lanosterol
synthase (2,3-oxidosqualene-lanosterol cyclase) (LSS),
the gene for a novel protein similar to human and mouse leishmanolysin-like
(metallopeptidase M8 family) (LMLN), the
gene for a novel protein similar to vertebrate oxysterol binding
protein-like 10 (OSBPL10), the gene for a novel protein
similar to vertebrate transforming growth factor, beta receptor
II (70/80kDa) (TGFBR2), the snx4 gene for sorting nexin
4, the gene for a novel protein similar to vertebrate zinc
finger protein 148 (ZNF148) and the 5' end of the gene for a
novel protein similar to vertebrate solute carrier family 12
(potassium/chloride transporters), member 8 (SLC12A8), complete
sequence
Length=185559
 
Score = 39.2 bits (42), Expect = 5.0
Identities = 21/21 (100%), Gaps = 0/21 (0%)
Strand=Plus/Plus
 
Query 62 GCTGTTATAACAGAAACCACT 82
|||||||||||||||||||||
Sbjct 124003 GCTGTTATAACAGAAACCACT 124023
 
 
 
Lambda K H
0.634 0.408 0.912
 
Gapped
Lambda K H
0.625 0.410 0.780
 
Effective search space used: 3062586391620
 
 
Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
Posted date: May 21, 2011 4:39 PM
Number of letters in database: 36,075,095,184
Number of sequences in database: 14,049,258
 
 
 
Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2

Please sign in to comment on this gist.

Something went wrong with that request. Please try again.