Skip to content

anonymous /gist:1248342

Embed URL

HTTPS clone URL

Subversion checkout URL

You can clone with
or
.
Download ZIP
BLASTN 2.2.25+
Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.
Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
14,049,258 sequences; 36,075,095,184 total letters
Query= GFAVMM201BADC0
Length=477
Score E
Sequences producing significant alignments: (Bits) Value
gi|194750627|ref|XM_001957596.1| Drosophila ananassae GF23929 (D... 42.8 2.1
gi|118568029|gb|CP000325.1| Mycobacterium ulcerans Agy99, comple... 42.8 2.1
gi|24395301|emb|AL928579.6| Mouse DNA sequence from clone RP23-3... 42.8 2.1
gi|326411376|gb|CP002568.1| Polymorphum gilvum SL003B-26A1, comp... 41.0 7.4
gi|317165637|gb|CP002447.1| Mesorhizobium ciceri biovar biserrul... 41.0 7.4
gi|312283773|gb|AC243242.1| Panicum virgatum clone PV_ABa051-K05... 41.0 7.4
gi|303315262|ref|XM_003067593.1| Coccidioides posadasii C735 del... 41.0 7.4
gi|297153409|gb|CP002047.1| Streptomyces bingchenggensis BCW-1, ... 41.0 7.4
gi|295434944|gb|CP002013.1| Burkholderia sp. CCGE1002 chromosome... 41.0 7.4
gi|283945692|gb|CP001854.1| Conexibacter woesei DSM 14684, compl... 41.0 7.4
gi|194346582|gb|CP001111.1| Stenotrophomonas maltophilia R551-3,... 41.0 7.4
gi|166857509|gb|CP000926.1| Pseudomonas putida GB-1, complete ge... 41.0 7.4
gi|148498119|gb|CP000699.1| Sphingomonas wittichii RW1, complete... 41.0 7.4
>gi|194750627|ref|XM_001957596.1| Drosophila ananassae GF23929 (Dana\GF23929), mRNA
Length=1641
Score = 42.8 bits (46), Expect = 2.1
Identities = 37/45 (83%), Gaps = 1/45 (2%)
Strand=Plus/Plus
Query 236 ACGCCGACGACAAGCGGCGAGTCCCTTGTGGACGATCTCGGCCAC 280
|||||||||||||| ||||||||| || |||| |||| ||||
Sbjct 137 ACGCCGACGACAAG-GGCGAGTCCATTTGGGACTTTCTCACCCAC 180
>gi|118568029|gb|CP000325.1| Mycobacterium ulcerans Agy99, complete genome
Length=5631606
Score = 42.8 bits (46), Expect = 2.1
Identities = 36/43 (84%), Gaps = 1/43 (2%)
Strand=Plus/Minus
Query 69 CCATGACTGCCGGCAGAACATCGACCGGCCAG-TATGTCGGCC 110
||||| ||||||||||||| |||| || || | |||| |||||
Sbjct 890715 CCATGTCTGCCGGCAGAACTTCGAGCGACCCGATATGGCGGCC 890673
>gi|24395301|emb|AL928579.6| Mouse DNA sequence from clone RP23-302M15 on chromosome 4, complete
sequence
Length=184057
Score = 42.8 bits (46), Expect = 2.1
Identities = 31/35 (89%), Gaps = 1/35 (2%)
Strand=Plus/Plus
Query 437 AGCTGCAACATGAATGTGCTCGCAGATCTTCAGGA 471
|||||||||||| ||||||| ||||| |||| |||
Sbjct 146437 AGCTGCAACATGGATGTGCTAGCAGA-CTTCTGGA 146470
>gi|326411376|gb|CP002568.1| Polymorphum gilvum SL003B-26A1, complete genome
Length=4649365
Score = 41.0 bits (44), Expect = 7.4
Identities = 33/40 (83%), Gaps = 0/40 (0%)
Strand=Plus/Plus
Query 238 GCCGACGACAAGCGGCGAGTCCCTTGTGGACGATCTCGGC 277
||||||||| ||||||||||| | ||| |||| |||||
Sbjct 2023755 GCCGACGACGCGCGGCGAGTCCGTGGTGCTCGATGTCGGC 2023794
>gi|317165637|gb|CP002447.1| Mesorhizobium ciceri biovar biserrulae WSM1271, complete genome
Length=6264489
Score = 41.0 bits (44), Expect = 7.4
Identities = 22/22 (100%), Gaps = 0/22 (0%)
Strand=Plus/Plus
Query 300 TTGATGCCGAGGCGGATGCCAT 321
||||||||||||||||||||||
Sbjct 4510008 TTGATGCCGAGGCGGATGCCAT 4510029
>gi|312283773|gb|AC243242.1| Panicum virgatum clone PV_ABa051-K05, complete sequence
Length=161398
Score = 41.0 bits (44), Expect = 7.4
Identities = 28/32 (88%), Gaps = 0/32 (0%)
Strand=Plus/Plus
Query 271 TCTCGGCCACCTGTTTGAGTGGTATTCTTTTG 302
||| |||||||||||||||| ||||| || ||
Sbjct 137850 TCTTGGCCACCTGTTTGAGTTGTATTTTTCTG 137881
>gi|303315262|ref|XM_003067593.1| Coccidioides posadasii C735 delta SOWgp Sugar transporter family
protein, mRNA
Length=1947
Score = 41.0 bits (44), Expect = 7.4
Identities = 31/37 (84%), Gaps = 0/37 (0%)
Strand=Plus/Minus
Query 289 GTGGTATTCTTTTGATGCCGAGGCGGATGCCATTGCA 325
||||| ||| | ||||||||||||| | ||| |||||
Sbjct 84 GTGGTCTTCATATGATGCCGAGGCGTAAGCCTTTGCA 48
>gi|297153409|gb|CP002047.1| Streptomyces bingchenggensis BCW-1, complete genome
Length=11936683
Score = 41.0 bits (44), Expect = 7.4
Identities = 27/30 (90%), Gaps = 0/30 (0%)
Strand=Plus/Plus
Query 38 GTCGGCAGCGGATCTCCGAAAACCATCAAG 67
|||||||||||| ||||||| ||||||||
Sbjct 3073377 GTCGGCAGCGGAACTCCGAATTCCATCAAG 3073406
>gi|295434944|gb|CP002013.1| Burkholderia sp. CCGE1002 chromosome 1, complete sequence
Length=3518940
Score = 41.0 bits (44), Expect = 7.4
Identities = 33/40 (83%), Gaps = 0/40 (0%)
Strand=Plus/Minus
Query 212 ATGGGCGAATCGATCACCTTCAACACGCCGACGACAAGCG 251
|| |||||||||||| | |||||||||| | ||| ||||
Sbjct 2243828 ATCGGCGAATCGATCGCGTTCAACACGCTGGCGATGAGCG 2243789
>gi|283945692|gb|CP001854.1| Conexibacter woesei DSM 14684, complete genome
Length=6359369
Score = 41.0 bits (44), Expect = 7.4
Identities = 35/43 (82%), Gaps = 3/43 (6%)
Strand=Plus/Minus
Query 101 TATGTCGGCCATGGCTTCTACAGTCCGGACATGATCGACGGCG 143
||||||||||| | ||||||| ||| || || |||||||||
Sbjct 2039361 TATGTCGGCCACGACTTCTAC---CCGAACCTGGTCGACGGCG 2039322
>gi|194346582|gb|CP001111.1| Stenotrophomonas maltophilia R551-3, complete genome
Length=4573969
Score = 41.0 bits (44), Expect = 7.4
Identities = 32/36 (89%), Gaps = 2/36 (5%)
Strand=Plus/Minus
Query 102 ATGTCGGCCATGGC-TTCTACAGTCCGGACATGATC 136
|||||||||||||| || |||| ||||||||||||
Sbjct 3897524 ATGTCGGCCATGGCGTTGCACAG-CCGGACATGATC 3897490
>gi|166857509|gb|CP000926.1| Pseudomonas putida GB-1, complete genome
Length=6078430
Score = 41.0 bits (44), Expect = 7.4
Identities = 35/41 (86%), Gaps = 2/41 (4%)
Strand=Plus/Minus
Query 222 CGATCACCTTCAACACG-CCGACGACAAGCGGCGAGTCCCT 261
||||||||||| ||||| ||||||| ||||| | |||| ||
Sbjct 5087565 CGATCACCTTCGACACGTCCGACGA-AAGCGCCAAGTCGCT 5087526
>gi|148498119|gb|CP000699.1| Sphingomonas wittichii RW1, complete genome
Length=5382261
Score = 41.0 bits (44), Expect = 7.4
Identities = 32/38 (85%), Gaps = 3/38 (7%)
Strand=Plus/Plus
Query 208 GACGATG---GGCGAATCGATCACCTTCAACACGCCGA 242
||||||| |||| |||||||||||||| |||||||
Sbjct 4265124 GACGATGTGGGGCGGCTCGATCACCTTCAAGACGCCGA 4265161
Lambda K H
0.634 0.408 0.912
Gapped
Lambda K H
0.625 0.410 0.780
Effective search space used: 15727850050068
Query= GFAVMM201A1JOH
Length=57
Score E
Sequences producing significant alignments: (Bits) Value
gi|22416007|emb|AL772315.4| Mouse DNA sequence from clone RP23-5... 41.0 0.42
gi|117168385|gb|AC190175.4| Pan troglodytes BAC clone CH251-542A... 39.2 1.5
gi|45238691|gb|AC145377.2| Pan troglodytes BAC clone RP43-11P19 ... 39.2 1.5
gi|4926907|gb|AC004936.2| Homo sapiens PAC clone RP5-959C21 from... 39.2 1.5
gi|31414500|emb|AL831797.4| Oryza sativa chromosome 12, . BAC OS... 39.2 1.5
gi|158967071|gb|CP000033.3| Lactobacillus acidophilus NCFM, comp... 37.4 5.1
>gi|22416007|emb|AL772315.4| Mouse DNA sequence from clone RP23-54A13 on chromosome 4, complete
sequence
Length=200266
Score = 41.0 bits (44), Expect = 0.42
Identities = 28/31 (91%), Gaps = 2/31 (6%)
Strand=Plus/Minus
Query 6 CGTTCCAGTCACGATACATACCAATAACGAC 36
||||||||| | ||||||||||||||||||
Sbjct 26821 CGTTCCAGTGA--ATACATACCAATAACGAC 26793
>gi|117168385|gb|AC190175.4| Pan troglodytes BAC clone CH251-542A7 from chromosome 7, complete
sequence
Length=214222
Score = 39.2 bits (42), Expect = 1.5
Identities = 26/29 (90%), Gaps = 0/29 (0%)
Strand=Plus/Minus
Query 19 ATACATACCAATAACGACTTCTATATGTA 47
|||||||||||||| | |||||||||||
Sbjct 166678 ATACATACCAATAAATATTTCTATATGTA 166650
>gi|45238691|gb|AC145377.2| Pan troglodytes BAC clone RP43-11P19 from chromosome 7, complete
sequence
Length=194463
Score = 39.2 bits (42), Expect = 1.5
Identities = 26/29 (90%), Gaps = 0/29 (0%)
Strand=Plus/Plus
Query 19 ATACATACCAATAACGACTTCTATATGTA 47
|||||||||||||| | |||||||||||
Sbjct 192749 ATACATACCAATAAATATTTCTATATGTA 192777
>gi|4926907|gb|AC004936.2| Homo sapiens PAC clone RP5-959C21 from 7, complete sequence
Length=139949
Score = 39.2 bits (42), Expect = 1.5
Identities = 26/29 (90%), Gaps = 0/29 (0%)
Strand=Plus/Minus
Query 19 ATACATACCAATAACGACTTCTATATGTA 47
|||||||||||||| | |||||||||||
Sbjct 12654 ATACATACCAATAAATATTTCTATATGTA 12626
>gi|31414500|emb|AL831797.4| Oryza sativa chromosome 12, . BAC OSJNBa0010M16 of library OSJNBa
from chromosome 12 of cultivar Nipponbare of ssp. japonica
of Oryza sativa (rice), complete sequence
Length=132741
Score = 39.2 bits (42), Expect = 1.5
Identities = 23/24 (96%), Gaps = 0/24 (0%)
Strand=Plus/Plus
Query 18 GATACATACCAATAACGACTTCTA 41
||||||||||||||| ||||||||
Sbjct 126346 GATACATACCAATAAAGACTTCTA 126369
>gi|158967071|gb|CP000033.3| Lactobacillus acidophilus NCFM, complete genome
Length=1993560
Score = 37.4 bits (40), Expect = 5.1
Identities = 20/20 (100%), Gaps = 0/20 (0%)
Strand=Plus/Minus
Query 14 TCACGATACATACCAATAAC 33
||||||||||||||||||||
Sbjct 756012 TCACGATACATACCAATAAC 755993
Lambda K H
0.634 0.408 0.912
Gapped
Lambda K H
0.625 0.410 0.780
Effective search space used: 890637973200
Query= GFAVMM201D933Z
Length=119
Score E
Sequences producing significant alignments: (Bits) Value
gi|332189094|gb|CP002684.1| Arabidopsis thaliana chromosome 1, c... 41.0 1.4
gi|313747610|gb|AC237431.3| Macaca mulatta Y Chr BAC RMAEX-106G5... 41.0 1.4
gi|168693784|gb|AC213321.3| MACACA MULATTA BAC clone CH250-541A1... 41.0 1.4
gi|8778954|gb|AC007932.3|F11A17 Arabidopsis thaliana chromosome ... 41.0 1.4
gi|256052438|ref|XM_002569731.1| Schistosoma mansoni GTP-binding... 39.2 5.0
gi|238867551|gb|CP001600.1| Edwardsiella ictaluri 93-146, comple... 39.2 5.0
gi|224465197|ref|NG_009929.1| Homo sapiens like-glycosyltransfer... 39.2 5.0
gi|147784643|emb|AM469007.2| Vitis vinifera contig VV78X098884.1... 39.2 5.0
gi|123663234|emb|AM455601.1| Vitis vinifera, whole genome shotgu... 39.2 5.0
gi|118344518|gb|AC192748.2| Gallus gallus BAC clone CH261-166H21... 39.2 5.0
gi|90309320|gb|AY607844.2| Edwardsiella ictaluri transposase-lik... 39.2 5.0
gi|55908997|gb|AC102414.8| Mus musculus chromosome 15, clone RP2... 39.2 5.0
gi|72096292|gb|AC162857.5| Mus musculus chromosome 15, clone RP2... 39.2 5.0
gi|22415845|emb|AL139016.8| Human DNA sequence from clone RP4-65... 39.2 5.0
gi|6572307|emb|Z82173.2| Human DNA sequence from clone SC22CB-1D... 39.2 5.0
gi|56410822|gb|AC140454.4| Mus musculus BAC clone RP24-163I14 fr... 39.2 5.0
gi|38707373|emb|BX255930.3| Zebrafish DNA sequence from clone DK... 39.2 5.0
>gi|332189094|gb|CP002684.1| Arabidopsis thaliana chromosome 1, complete sequence
Length=30427671
Score = 41.0 bits (44), Expect = 1.4
Identities = 25/27 (93%), Gaps = 0/27 (0%)
Strand=Plus/Minus
Query 70 AACAGAAACCACTACGAAAGGAAAGAA 96
||||||||| ||||||||||||||||
Sbjct 17871124 AACAGAAACTTCTACGAAAGGAAAGAA 17871098
>gi|313747610|gb|AC237431.3| Macaca mulatta Y Chr BAC RMAEX-106G5 complete sequence
Length=169910
Score = 41.0 bits (44), Expect = 1.4
Identities = 28/31 (91%), Gaps = 2/31 (6%)
Strand=Plus/Minus
Query 75 AAACCACTACGAAAGGAAAGAAATGCCTCTA 105
|||||| ||||||||||| |||||||||||
Sbjct 60448 AAACCA--ACGAAAGGAAATAAATGCCTCTA 60420
>gi|168693784|gb|AC213321.3| MACACA MULATTA BAC clone CH250-541A11 from chromosome y, complete
sequence
Length=156689
Score = 41.0 bits (44), Expect = 1.4
Identities = 28/31 (91%), Gaps = 2/31 (6%)
Strand=Plus/Plus
Query 75 AAACCACTACGAAAGGAAAGAAATGCCTCTA 105
|||||| ||||||||||| |||||||||||
Sbjct 62327 AAACCA--ACGAAAGGAAATAAATGCCTCTA 62355
>gi|8778954|gb|AC007932.3|F11A17 Arabidopsis thaliana chromosome 1 BAC F11A17 sequence, complete
sequence
Length=102078
Score = 41.0 bits (44), Expect = 1.4
Identities = 25/27 (93%), Gaps = 0/27 (0%)
Strand=Plus/Plus
Query 70 AACAGAAACCACTACGAAAGGAAAGAA 96
||||||||| ||||||||||||||||
Sbjct 32940 AACAGAAACTTCTACGAAAGGAAAGAA 32966
>gi|256052438|ref|XM_002569731.1| Schistosoma mansoni GTP-binding protein era, putative (Smp_164220)
mRNA, complete cds
Length=1341
Score = 39.2 bits (42), Expect = 5.0
Identities = 21/21 (100%), Gaps = 0/21 (0%)
Strand=Plus/Minus
Query 40 TTCTCTTTTCGTATTTGGAAC 60
|||||||||||||||||||||
Sbjct 159 TTCTCTTTTCGTATTTGGAAC 139
>gi|238867551|gb|CP001600.1| Edwardsiella ictaluri 93-146, complete genome
Length=3812315
Score = 39.2 bits (42), Expect = 5.0
Identities = 31/37 (84%), Gaps = 3/37 (8%)
Strand=Plus/Plus
Query 58 AACAGCTGTTATA---ACAGAAACCACTACGAAAGGA 91
|||||| |||||| ||| ||||||||||| |||||
Sbjct 1978968 AACAGCCGTTATATCCACATAAACCACTACGCAAGGA 1979004
>gi|224465197|ref|NG_009929.1| Homo sapiens like-glycosyltransferase (LARGE), RefSeqGene on
chromosome 22
Length=654355
Score = 39.2 bits (42), Expect = 5.0
Identities = 30/36 (84%), Gaps = 0/36 (0%)
Strand=Plus/Plus
Query 66 TTATAACAGAAACCACTACGAAAGGAAAGAAATGCC 101
||| ||||||||||| || |||||||| ||| |||
Sbjct 603836 TTAAAACAGAAACCAAAACCAAAGGAAAAAAAAGCC 603871
>gi|147784643|emb|AM469007.2| Vitis vinifera contig VV78X098884.11, whole genome shotgun sequence
Length=7756
Score = 39.2 bits (42), Expect = 5.0
Identities = 24/26 (93%), Gaps = 0/26 (0%)
Strand=Plus/Minus
Query 71 ACAGAAACCACTACGAAAGGAAAGAA 96
||| |||||||||| |||||||||||
Sbjct 6827 ACAAAAACCACTACAAAAGGAAAGAA 6802
>gi|123663234|emb|AM455601.1| Vitis vinifera, whole genome shotgun sequence, contig VV78X123660.5,
clone ENTAV 115
Length=34741
Score = 39.2 bits (42), Expect = 5.0
Identities = 24/26 (93%), Gaps = 0/26 (0%)
Strand=Plus/Plus
Query 71 ACAGAAACCACTACGAAAGGAAAGAA 96
||| |||||||||| |||||||||||
Sbjct 34120 ACAAAAACCACTACAAAAGGAAAGAA 34145
>gi|118344518|gb|AC192748.2| Gallus gallus BAC clone CH261-166H21 from chromosome z, complete
sequence
Length=226699
Score = 39.2 bits (42), Expect = 5.0
Identities = 27/31 (88%), Gaps = 0/31 (0%)
Strand=Plus/Plus
Query 58 AACAGCTGTTATAACAGAAACCACTACGAAA 88
||||||||| |||||||||||| || ||||
Sbjct 178051 AACAGCTGTCATAACAGAAACCCATATGAAA 178081
>gi|90309320|gb|AY607844.2| Edwardsiella ictaluri transposase-like protein gene, complete
cds; urease operon, complete sequence; and ammonium transporter
(amtB) and TnpA (tnpA) genes, complete cds
Length=11426
Score = 39.2 bits (42), Expect = 5.0
Identities = 31/37 (84%), Gaps = 3/37 (8%)
Strand=Plus/Minus
Query 58 AACAGCTGTTATA---ACAGAAACCACTACGAAAGGA 91
|||||| |||||| ||| ||||||||||| |||||
Sbjct 8030 AACAGCCGTTATATCCACATAAACCACTACGCAAGGA 7994
>gi|55908997|gb|AC102414.8| Mus musculus chromosome 15, clone RP24-474D5, complete sequence
Length=159739
Score = 39.2 bits (42), Expect = 5.0
Identities = 24/26 (93%), Gaps = 0/26 (0%)
Strand=Plus/Plus
Query 70 AACAGAAACCACTACGAAAGGAAAGA 95
||||||||||||||| |||||| |||
Sbjct 71851 AACAGAAACCACTACAAAAGGAGAGA 71876
>gi|72096292|gb|AC162857.5| Mus musculus chromosome 15, clone RP23-333C11, complete sequence
Length=224913
Score = 39.2 bits (42), Expect = 5.0
Identities = 24/26 (93%), Gaps = 0/26 (0%)
Strand=Plus/Minus
Query 70 AACAGAAACCACTACGAAAGGAAAGA 95
||||||||||||||| |||||| |||
Sbjct 3370 AACAGAAACCACTACAAAAGGAGAGA 3345
>gi|22415845|emb|AL139016.8| Human DNA sequence from clone RP4-658C17 on chromosome 1p11.1-13.3,
complete sequence
Length=100643
Score = 39.2 bits (42), Expect = 5.0
Identities = 22/23 (96%), Gaps = 0/23 (0%)
Strand=Plus/Plus
Query 87 AAGGAAAGAAATGCCTCTANAAG 109
||||||||||||||||||| |||
Sbjct 22086 AAGGAAAGAAATGCCTCTAGAAG 22108
>gi|6572307|emb|Z82173.2| Human DNA sequence from clone SC22CB-1D7 on chromosome 22 Contains
a novel gene and part of the LARGE gene for like-glycosyltransferase,
complete sequence
Length=37731
Score = 39.2 bits (42), Expect = 5.0
Identities = 30/36 (84%), Gaps = 0/36 (0%)
Strand=Plus/Minus
Query 66 TTATAACAGAAACCACTACGAAAGGAAAGAAATGCC 101
||| ||||||||||| || |||||||| ||| |||
Sbjct 15530 TTAAAACAGAAACCAAAACCAAAGGAAAAAAAAGCC 15495
>gi|56410822|gb|AC140454.4| Mus musculus BAC clone RP24-163I14 from 1, complete sequence
Length=171533
Score = 39.2 bits (42), Expect = 5.0
Identities = 28/32 (88%), Gaps = 4/32 (12%)
Strand=Plus/Plus
Query 66 TTATAACAGAAACCACTACGAAAGGAAAGAAA 97
|||||||||||||||| ||||||||||||
Sbjct 140248 TTATAACAGAAACCAC----AAAGGAAAGAAA 140275
>gi|38707373|emb|BX255930.3| Zebrafish DNA sequence from clone DKEY-101K6 in linkage group
9 Contains the 3' end of the mcm3ap gene for MCM3 minichromosome
maintenance deficient 3 (S. cerevisiae) associated protein,
the gene for a novel protein similar to vertebrate lanosterol
synthase (2,3-oxidosqualene-lanosterol cyclase) (LSS),
the gene for a novel protein similar to human and mouse leishmanolysin-like
(metallopeptidase M8 family) (LMLN), the
gene for a novel protein similar to vertebrate oxysterol binding
protein-like 10 (OSBPL10), the gene for a novel protein
similar to vertebrate transforming growth factor, beta receptor
II (70/80kDa) (TGFBR2), the snx4 gene for sorting nexin
4, the gene for a novel protein similar to vertebrate zinc
finger protein 148 (ZNF148) and the 5' end of the gene for a
novel protein similar to vertebrate solute carrier family 12
(potassium/chloride transporters), member 8 (SLC12A8), complete
sequence
Length=185559
Score = 39.2 bits (42), Expect = 5.0
Identities = 21/21 (100%), Gaps = 0/21 (0%)
Strand=Plus/Plus
Query 62 GCTGTTATAACAGAAACCACT 82
|||||||||||||||||||||
Sbjct 124003 GCTGTTATAACAGAAACCACT 124023
Lambda K H
0.634 0.408 0.912
Gapped
Lambda K H
0.625 0.410 0.780
Effective search space used: 3062586391620
Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
Posted date: May 21, 2011 4:39 PM
Number of letters in database: 36,075,095,184
Number of sequences in database: 14,049,258
Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
Something went wrong with that request. Please try again.