Skip to content
Hi all,
Cluless newbie here (first time touching Perl 48 hours ago...), for which apologies.
I'm trying to take a genbank file (.gb), and create a FASTA file with a specific identifier line for each sequence. Specifically, I want the "host" tag as the identifier. With the help of the Bioperl beginner readme and the HOWTO's (which are great!) I've worked out how to loop through my sequences and get the 'host' tag for each one. For some reason, I get two identifier lines for each sequence. I guess the problem is in the 'for' loop--it's running the stuff below it twice, once with the actual 'host' tag data and once with...nothing? Not sure.
I think I can work out how to use s/ and a regex just to delete the second identifier line, but that feels like I'm avoiding the problem instead of fixing it. Any help appreciated!
Many thanks,
haywardjeremya@gmail.com
LOCUS JQ724057 360 bp DNA linear ENV 15-MAY-2012
DEFINITION Uncultured Hebeloma clone PN_2Be_III 18S ribosomal RNA gene,
partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA
gene, and internal transcribed spacer 2, complete sequence; and 28S
ribosomal RNA gene, partial sequence.
ACCESSION JQ724057
VERSION JQ724057.1 GI:387145978
KEYWORDS ENV.
SOURCE uncultured Hebeloma
ORGANISM uncultured Hebeloma
Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina;
Agaricomycetes; Agaricomycetidae; Agaricales; Cortinariaceae;
environmental samples.
REFERENCE 1 (bases 1 to 360)
AUTHORS Hrynkiewicz,K., Toljander,Y.K., Baum,C., Fransson,P.M., Taylor,A.F.
and Weih,M.
TITLE Correspondence of ectomycorrhizal diversity and colonisation of
willows (Salix spp.) grown in short rotation coppice on arable
sites and adjacent natural stands
JOURNAL Mycorrhiza (2012) In press
PUBMED 22415721
REMARK Publication Status: Available-Online prior to print
REFERENCE 2 (bases 1 to 360)
AUTHORS Hrynkiewicz,K., Toljander,Y.K., Baum,C., Fransson,P.M.A.,
Taylor,A.S.F. and Weih,M.
TITLE Direct Submission
JOURNAL Submitted (28-FEB-2012) Department of Microbiology, Institute of
General and Molecular Biology, Gagarina 9, Torun, Torun PL-87-100,
Poland
FEATURES Location/Qualifiers
source 1..360
/organism="uncultured Hebeloma"
/mol_type="genomic DNA"
/isolation_source="ectomycorrhiza of Salix fragilis"
/db_xref="taxon:210223"
/clone="PN_2Be_III"
/environmental_sample
/country="Sweden: natural/naturalized willow site NWS2"
/lat_lon="59.49 N 17.40 E"
/collection_date="Jun-2005"
/note="submitted as Helotiales sp. 1
PCR_primers=fwd_name: ITS1, rev_name: ITS4"
misc_RNA <1..>360
/note="contains 18S ribosomal RNA, internal transcribed
spacer 1, 5.8S ribosomal RNA, internal transcribed spacer
2, and 28S ribosomal RNA"
ORIGIN
1 gccccgtttt ttgaaatggg ttctattccc aaaccgtgta tacataccta tgttgctttg
61 gtaggccgcc ttttaggcgt cggctccggc tgactgcgcc tgccagagga cccaaactct
121 tttgtttagt gatgtctgag tactatataa tagttaaaac tttcaacaac ggatctcttg
181 gttctggcat cgatgaagaa cgcagcgaaa tgcgataagt aatgtgaatt gcagaattca
241 gtgaatcatc gaatctttga acgcacattg cgccccttgg tattccgagg ggcatgcctg
301 ttcgagcgtc attataacca ctcaagcctc ggcttggtct tggggttcgc ggtctcgcgg
//
LOCUS JQ724055 580 bp DNA linear ENV 15-MAY-2012
DEFINITION Uncultured Hebeloma clone PN_2Aa_I 18S ribosomal RNA gene, partial
sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene,
and internal transcribed spacer 2, complete sequence; and 28S
ribosomal RNA gene, partial sequence.
ACCESSION JQ724055
VERSION JQ724055.1 GI:387145976
KEYWORDS ENV.
SOURCE uncultured Hebeloma
ORGANISM uncultured Hebeloma
Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina;
Agaricomycetes; Agaricomycetidae; Agaricales; Cortinariaceae;
environmental samples.
REFERENCE 1 (bases 1 to 580)
AUTHORS Hrynkiewicz,K., Toljander,Y.K., Baum,C., Fransson,P.M., Taylor,A.F.
and Weih,M.
TITLE Correspondence of ectomycorrhizal diversity and colonisation of
willows (Salix spp.) grown in short rotation coppice on arable
sites and adjacent natural stands
JOURNAL Mycorrhiza (2012) In press
PUBMED 22415721
REMARK Publication Status: Available-Online prior to print
REFERENCE 2 (bases 1 to 580)
AUTHORS Hrynkiewicz,K., Toljander,Y.K., Baum,C., Fransson,P.M.A.,
Taylor,A.S.F. and Weih,M.
TITLE Direct Submission
JOURNAL Submitted (28-FEB-2012) Department of Microbiology, Institute of
General and Molecular Biology, Gagarina 9, Torun, Torun PL-87-100,
Poland
FEATURES Location/Qualifiers
source 1..580
/organism="uncultured Hebeloma"
/mol_type="genomic DNA"
/isolation_source="ectomycorrhiza of Salix fragilis"
/db_xref="taxon:210223"
/clone="PN_2Aa_I"
/environmental_sample
/country="Sweden: natural/naturalized willow site NWS2"
/lat_lon="59.49 N 17.40 E"
/collection_date="Jun-2005"
/note="submitted as Helotiales sp. 2
PCR_primers=fwd_name: ITS1, rev_name: ITS4"
misc_RNA <1..>580
/note="contains 18S ribosomal RNA, internal transcribed
spacer 1, 5.8S ribosomal RNA, internal transcribed spacer
2, and 28S ribosomal RNA"
ORIGIN
1 tcttggtcat ttagaggaag taaaagtcgt aacaaggttt ccgtaggtga acctgcggaa
61 ggatcattac agagttcatg cccttacggg tagatctccc accctttgag tactatactt
121 ttgttgcttt ggcaggccgc ttcggctacc ggcttcggct ggtgagtgcc tgccagagga
181 ccccaaactc tgaattatag tgtcgtctga gaactatata atagttaaaa ctttcaacaa
241 cggatctctt ggttctggca tcgatgaaga acgcagcgaa atgcgataag taatgtgaat
301 tgcagaattc agtgaatcat cgaatctttg aacgcacatt gcgccccttg gtattccggg
361 gggcatgcct gttcgagcgt cattataacc ctcaagccta gcttggtgtt ggagcctgcc
421 tctgggcagc tcttaaaatc agtggcggtg ccgtctggct ctaagcgtag taattcttct
481 cgctacagag tcccggcggt tgcttgccaa caaccccaaa ttttctatgg ttgacctcgg
541 atcaggtagg gatacccgct gaacttaagc atatcaataa
//
LOCUS JQ724053 517 bp DNA linear ENV 15-MAY-2012
DEFINITION Uncultured Hebeloma clone PN_1Ae_V 18S ribosomal RNA gene, partial
sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene,
and internal transcribed spacer 2, complete sequence; and 28S
ribosomal RNA gene, partial sequence.
ACCESSION JQ724053
VERSION JQ724053.1 GI:387145974
KEYWORDS ENV.
SOURCE uncultured Hebeloma
ORGANISM uncultured Hebeloma
Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina;
Agaricomycetes; Agaricomycetidae; Agaricales; Cortinariaceae;
environmental samples.
REFERENCE 1 (bases 1 to 517)
AUTHORS Hrynkiewicz,K., Toljander,Y.K., Baum,C., Fransson,P.M., Taylor,A.F.
and Weih,M.
TITLE Correspondence of ectomycorrhizal diversity and colonisation of
willows (Salix spp.) grown in short rotation coppice on arable
sites and adjacent natural stands
JOURNAL Mycorrhiza (2012) In press
PUBMED 22415721
REMARK Publication Status: Available-Online prior to print
REFERENCE 2 (bases 1 to 517)
AUTHORS Hrynkiewicz,K., Toljander,Y.K., Baum,C., Fransson,P.M.A.,
Taylor,A.S.F. and Weih,M.
TITLE Direct Submission
JOURNAL Submitted (28-FEB-2012) Department of Microbiology, Institute of
General and Molecular Biology, Gagarina 9, Torun, Torun PL-87-100,
Poland
FEATURES Location/Qualifiers
source 1..517
/organism="uncultured Hebeloma"
/mol_type="genomic DNA"
/isolation_source="ectomycorrhiza of Salix fragilis"
/db_xref="taxon:210223"
/clone="PN_1Ae_V"
/environmental_sample
/country="Sweden: natural/naturalized willow site NWS2"
/lat_lon="59.49 N 17.40 E"
/collection_date="Jun-2005"
/note="submitted as Helotiales sp. 1
PCR_primers=fwd_name: ITS1, rev_name: ITS4"
misc_RNA <1..>517
/note="contains 18S ribosomal RNA, internal transcribed
spacer 1, 5.8S ribosomal RNA, internal transcribed spacer
2, and 28S ribosomal RNA"
ORIGIN
1 tggtaagaga gtgcaggatg aacaatggac gatccgcagc gaagacccta ccggcgagag
61 cccacgggta ccgttcacag actaagtgat tgtgggcggg gcgtcaggcc ctgtctaaga
121 tatagtcggt ctctgctcga aaggtcagag cctagcgcgt ccgtaggtga acctgcggaa
181 ggatcattaa agaatcgccc cgttttttga aatgggttct attcccaaac cgtgtataca
241 tacctttgtt gctttggtag gccgccttct aggcgtcggc tccggctgac tgcgcctgcc
301 agaggaccca aactcgtttg tttagtgatg tctgagtact atataatagt taaaactttc
361 aacaacggat ctcttggttc tggcatcgat gaagaacgca gcgaaatgcg ataagtaatg
421 tgaattgcag aattcagtga atcatcgaat ctttgaacgc acattgcgcc ccttggtatt
481 ccgaggggca tgcctgttcg agcgtcatta caaccac
//
LOCUS JQ724051 685 bp DNA linear ENV 15-MAY-2012
DEFINITION Uncultured Tomentella clone PN_3Aa_I 18S ribosomal RNA gene,
partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA
gene, and internal transcribed spacer 2, complete sequence; and 28S
ribosomal RNA gene, partial sequence.
ACCESSION JQ724051
VERSION JQ724051.1 GI:387145972
KEYWORDS ENV.
SOURCE uncultured Tomentella
ORGANISM uncultured Tomentella
Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina;
Agaricomycetes; Thelephorales; Thelephoraceae; environmental
samples.
REFERENCE 1 (bases 1 to 685)
AUTHORS Hrynkiewicz,K., Toljander,Y.K., Baum,C., Fransson,P.M., Taylor,A.F.
and Weih,M.
TITLE Correspondence of ectomycorrhizal diversity and colonisation of
willows (Salix spp.) grown in short rotation coppice on arable
sites and adjacent natural stands
JOURNAL Mycorrhiza (2012) In press
PUBMED 22415721
REMARK Publication Status: Available-Online prior to print
REFERENCE 2 (bases 1 to 685)
AUTHORS Hrynkiewicz,K., Toljander,Y.K., Baum,C., Fransson,P.M.A.,
Taylor,A.S.F. and Weih,M.
TITLE Direct Submission
JOURNAL Submitted (28-FEB-2012) Department of Microbiology, Institute of
General and Molecular Biology, Gagarina 9, Torun, Torun PL-87-100,
Poland
FEATURES Location/Qualifiers
source 1..685
/organism="uncultured Tomentella"
/mol_type="genomic DNA"
/isolation_source="ectomycorrhiza of Salix fragilis"
/db_xref="taxon:246176"
/clone="PN_3Aa_I"
/environmental_sample
/country="Sweden: natural/naturalized willow site NWS2"
/lat_lon="59.49 N 17.40 E"
/collection_date="Jun-2005"
/note="submitted as Tomentella cf. coerulea
PCR_primers=fwd_name: ITS1, rev_name: ITS4"
misc_RNA <1..>685
/note="contains 18S ribosomal RNA, internal transcribed
spacer 1, 5.8S ribosomal RNA, internal transcribed spacer
2, and 28S ribosomal RNA"
ORIGIN
1 agaggaagta aaagtcgtaa caaggtttcc gtaggtgaac ctgcggaagg atcattactg
61 aactgttgac acgagttgtt gctggtcctt gaaagggggc atgtgcacac tctgtttaca
121 catccactca cacctgtgca ccctctgtag ttctgtggca ttggggactc tgtcctcttg
181 ctgtggtcct acgtctttac acacacacac cgtaatacag tctcatggaa tgtatgtcgc
241 gtttaacgca atacaataca actttcagca acggatctct tggctctcgc atcgatgaag
301 aacgcagcga aatgcgataa gtaatgtgaa ttgcagaatt cagtgaatca tcgaatcttt
361 gaacgcacct tgcgcccttt ggctattccg aagggcatgc ctgtttgagt atcatgaaca
421 cctcaactct catggcctgc catgatgagc ttggattttg ggggtcttgc tggcctaacc
481 gtcggctcct ctcaaatgaa tcagcttgcc agtgtttggt ggcatcacag gtgtgataac
541 tatctacgct tgtggttctc caccaggtaa ccttcagcaa tggaggttcg ctggagctca
601 cagatgtctc tccccaggga cagctttttg aacgtttgat ctcaaatcag gtaggactac
661 ccgctgaact taagcatatc aataa
//
LOCUS JQ724047 618 bp DNA linear ENV 15-MAY-2012
DEFINITION Uncultured Tomentella clone PN_1Ab_I 18S ribosomal RNA gene,
partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA
gene, and internal transcribed spacer 2, complete sequence; and 28S
ribosomal RNA gene, partial sequence.
ACCESSION JQ724047
VERSION JQ724047.1 GI:387145968
KEYWORDS ENV.
SOURCE uncultured Tomentella
ORGANISM uncultured Tomentella
Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina;
Agaricomycetes; Thelephorales; Thelephoraceae; environmental
samples.
REFERENCE 1 (bases 1 to 618)
AUTHORS Hrynkiewicz,K., Toljander,Y.K., Baum,C., Fransson,P.M., Taylor,A.F.
and Weih,M.
TITLE Correspondence of ectomycorrhizal diversity and colonisation of
willows (Salix spp.) grown in short rotation coppice on arable
sites and adjacent natural stands
JOURNAL Mycorrhiza (2012) In press
PUBMED 22415721
REMARK Publication Status: Available-Online prior to print
REFERENCE 2 (bases 1 to 618)
AUTHORS Hrynkiewicz,K., Toljander,Y.K., Baum,C., Fransson,P.M.A.,
Taylor,A.S.F. and Weih,M.
TITLE Direct Submission
JOURNAL Submitted (28-FEB-2012) Department of Microbiology, Institute of
General and Molecular Biology, Gagarina 9, Torun, Torun PL-87-100,
Poland
FEATURES Location/Qualifiers
source 1..618
/organism="uncultured Tomentella"
/mol_type="genomic DNA"
/isolation_source="ectomycorrhiza of Salix fragilis"
/db_xref="taxon:246176"
/clone="PN_1Ab_I"
/environmental_sample
/country="Sweden: natural/naturalized willow site NWS2"
/lat_lon="59.49 N 17.40 E"
/collection_date="Jun-2005"
/note="submitted as Tomentella sp. 2
PCR_primers=fwd_name: ITS1, rev_name: ITS4"
misc_RNA <1..>618
/note="contains 18S ribosomal RNA, internal transcribed
spacer 1, 5.8S ribosomal RNA, internal transcribed spacer
2, and 28S ribosomal RNA"
ORIGIN
1 acacgagttg ttgctggtcc tcaaacgggg gcatgtgcac gctctgttca cacatccact
61 cacacctgtg caccctctgt agttctatgg tctggggggg ctctgccctc tcgccgtggt
121 tctatgtctt tacacacgca ctgtaataaa gtttcatgga atgcatgacg cgtttaacgc
181 aatacaatac aactttcagc aacggatctc ttggctctcg catcgatgaa gaacgcagcg
241 aaatgcgata agtaatgtga attgcagaat tcagtgaatc atcgaatctt tgaacgcacc
301 ttgcgccctt tggtattcca gagggcatgc ctgtttgagt atcatgaaca cctcaactct
361 cacggtccgc cgtgatgagc ttggactttg ggggtcttgc tggcctgcgg gtcggctcct
421 ctcaaatgaa tcagcttgcc agtgtttggt ggcatcacgg gtgtgataac tatctacgct
481 tgtggttttc caccaggtaa ccttcagcaa tggaggttcg ctggggctca caaatgtctc
541 tcctcggtga ggacaacttc ttgaatgttt gatctcaaat caggtagggc tacccgctga
601 acttaagcat atcaataa
//
LOCUS JQ982978 478 bp DNA linear ENV 06-MAY-2012
DEFINITION Uncultured Thelephora clone 2 18S ribosomal RNA gene, partial
sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene,
and internal transcribed spacer 2, complete sequence; and 28S
ribosomal RNA gene, partial sequence.
ACCESSION JQ982978
VERSION JQ982978.1 GI:385845718
KEYWORDS ENV.
SOURCE uncultured Thelephora
ORGANISM uncultured Thelephora
Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina;
Agaricomycetes; Thelephorales; Thelephoraceae; environmental
samples.
REFERENCE 1 (bases 1 to 478)
AUTHORS Polle,A.
TITLE Ectomycorrhiza as a link between trees (Fagus sylvatica) and the
belowground food web
JOURNAL Unpublished
REFERENCE 2 (bases 1 to 478)
AUTHORS Polle,A.
TITLE Direct Submission
JOURNAL Submitted (21-MAR-2012) Forest Botany and Tree Physiology,
Buesgen-Institut, Buesgenweg 2, Goettingen 37077, Germany
FEATURES Location/Qualifiers
source 1..478
/organism="uncultured Thelephora"
/mol_type="genomic DNA"
/isolation_source="mycorrhizal root tip"
/host="Fagus sylvatica"
/db_xref="taxon:526474"
/clone="2"
/environmental_sample
/country="Germany"
/collection_date="Sep-2009"
/collected_by="K. Valtanen"
/identified_by="K. Valtanen"
/PCR_primers="fwd_name: ITS1F, fwd_seq:
cttggtcatttagaggaagtaa, rev_name: ITS4, rev_seq:
tcctccgcttattgatatgc"
/note="submitted as 'uncultured ectomycorrhiza
[Thelephora]'"
misc_RNA <1..>478
/note="contains internal transcribed spacer 1, 5.8S
ribosomal RNA, and internal transcribed spacer 2; may also
contain18S ribosomal RNA and 28S ribosomal RNA"
ORIGIN
1 agggggcatg tgcacgctct gttcacacat ccactcacac ctgtgcaccc tctgtagttc
61 tatggtctgg aggatgcacc gtcttccttc tgtagttcta cgtctttaca catacgccct
121 agtgaagttt tatggaatgt gtgccgcgtc taacgcaata caatacaact ttcagcaacg
181 gatctcttgg ctctcgcatc gatgaagaac gcagcgaaat gcgataagta atgtgaattg
241 cagaattcag tgaatcatcg aatctttgaa cgcaccttgc gccccttgga tattctgagg
301 ggcatgcctg tttgagtatc atgaacacct caactcctca tggtttgccg tgatgagctt
361 ggacttttgg aggttttgct ggccctgctg tcggctcctc tcaaatggat cagcttgcca
421 gtgtttggtg gcgtcatggg tgtgataact atctacgctt gtggccgtct gccaggta
//
LOCUS JQ982976 546 bp DNA linear ENV 06-MAY-2012
DEFINITION Uncultured Peziza clone 6.1 18S ribosomal RNA gene, partial
sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene,
and internal transcribed spacer 2, complete sequence; and 28S
ribosomal RNA gene, partial sequence.
ACCESSION JQ982976
VERSION JQ982976.1 GI:385845716
KEYWORDS ENV.
SOURCE uncultured Peziza
ORGANISM uncultured Peziza
Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
Pezizomycetes; Pezizales; Pezizaceae; environmental samples.
REFERENCE 1 (bases 1 to 546)
AUTHORS Polle,A.
TITLE Ectomycorrhiza as a link between trees (Fagus sylvatica) and the
belowground food web
JOURNAL Unpublished
REFERENCE 2 (bases 1 to 546)
AUTHORS Polle,A.
TITLE Direct Submission
JOURNAL Submitted (21-MAR-2012) Forest Botany and Tree Physiology,
Buesgen-Institut, Buesgenweg 2, Goettingen 37077, Germany
FEATURES Location/Qualifiers
source 1..546
/organism="uncultured Peziza"
/mol_type="genomic DNA"
/isolation_source="mycorrhizal root tip"
/host="Fagus sylvatica"
/db_xref="taxon:522718"
/clone="6.1"
/environmental_sample
/country="Germany"
/collection_date="Sep-2009"
/collected_by="K. Valtanen"
/identified_by="K. Valtanen"
/PCR_primers="fwd_name: ITS1F, fwd_seq:
cttggtcatttagaggaagtaa, rev_name: ITS4, rev_seq:
tcctccgcttattgatatgc"
/note="submitted as 'uncultured ectomycorrhiza [Peziza
succosa]'"
misc_RNA <1..>546
/note="contains internal transcribed spacer 1, 5.8S
ribosomal RNA, and internal transcribed spacer 2; may also
contain18S ribosomal RNA and 28S ribosomal RNA"
ORIGIN
1 aggtgaacct gcggaaggat cattattgat agtttgtatt atcaaaaacc cctttgttta
61 tcatttacca tgttgcttcc attggacaga ccggcaattg tgtatacaaa aagttggtcc
121 tctagttttg tgtttatttg gcactagcta gggagctgcc agtggataga atccaaataa
181 aaaattcgtg aagaaatata tattgtctga tttattagta taaaaaaaat aaaactttca
241 acaacggatc tctaggctct tgcatcgatg aagaacgcag tgaaatgcga taagtaatgt
301 gaattgcaga atctcgtgaa tcatcgaatc tttgaacgca cattgcgccc tatggaattc
361 tgtagggcat gcctgtctga gcgtcagcag ccaaaaaaat ccaaatcttt gtagataaag
421 atttggattt ggttaagaga tgtaatctgt gtaagaaccg gttactcttt tgaaatttaa
481 aggcagtatt gatcaatcca actgtaaacg tgataaaaca tttcgttttt attgttcgga
541 atgagc
//
LOCUS JQ982974 394 bp DNA linear ENV 06-MAY-2012
DEFINITION Uncultured Lactarius clone MT9 18S ribosomal RNA gene, partial
sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene,
and internal transcribed spacer 2, complete sequence; and 28S
ribosomal RNA gene, partial sequence.
ACCESSION JQ982974
VERSION JQ982974.1 GI:385845714
KEYWORDS ENV.
SOURCE uncultured Lactarius
ORGANISM uncultured Lactarius
Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina;
Agaricomycetes; Russulales; Russulaceae; environmental samples.
REFERENCE 1 (bases 1 to 394)
AUTHORS Polle,A.
TITLE Ectomycorrhiza as a link between trees (Fagus sylvatica) and the
belowground food web
JOURNAL Unpublished
REFERENCE 2 (bases 1 to 394)
AUTHORS Polle,A.
TITLE Direct Submission
JOURNAL Submitted (21-MAR-2012) Forest Botany and Tree Physiology,
Buesgen-Institut, Buesgenweg 2, Goettingen 37077, Germany
FEATURES Location/Qualifiers
source 1..394
/organism="uncultured Lactarius"
/mol_type="genomic DNA"
/isolation_source="mycorrhizal root tip"
/host="Fagus sylvatica"
/db_xref="taxon:228206"
/clone="MT9"
/environmental_sample
/country="Germany"
/collection_date="Sep-2009"
/collected_by="K. Valtanen"
/identified_by="K. Valtanen"
/PCR_primers="fwd_name: ITS1F, fwd_seq:
cttggtcatttagaggaagtaa, rev_name: ITS4, rev_seq:
tcctccgcttattgatatgc"
/note="submitted as 'uncultured ectomycorrhiza [Lactarius
subdulcis]'"
misc_RNA <1..>394
/note="contains internal transcribed spacer 1, 5.8S
ribosomal RNA, and internal transcribed spacer 2; may also
contain18S ribosomal RNA and 28S ribosomal RNA"
ORIGIN
1 ttgggatcat ctcggagggg gctcgcgttt tcacacaaac ccccctttta aaagtgtaga
61 atgacctcat ttatgcgcta acccgcaatc aatacaactt tcaacaacgg atctcttggc
121 tctcgcatcg atgaagaacg cagcgaaatg cgatacgtaa tgtgaattgc agaattcagt
181 gaatcatcga atctttgaac gcaccttgcg ccccttggta ttccgagggg cacacccgtt
241 tgagtgtcgt gaaaacctca acctccttgg tttcttctgg agaccaaagc aggcttggac
301 tttggaggcc tttgctggca cctctctttt gaaggccagc tcctcttaaa caaattagca
361 gggtcctctt tgccgatcct cgacgtgtga taag
//
LOCUS JQ982972 481 bp DNA linear ENV 06-MAY-2012
DEFINITION Uncultured Clavulina clone MT3.2 18S ribosomal RNA gene, partial
sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene,
and internal transcribed spacer 2, complete sequence; and 28S
ribosomal RNA gene, partial sequence.
ACCESSION JQ982972
VERSION JQ982972.1 GI:385845712
KEYWORDS ENV.
SOURCE uncultured Clavulina
ORGANISM uncultured Clavulina
Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina;
Agaricomycetes; Cantharellales; Clavulinaceae; environmental
samples.
REFERENCE 1 (bases 1 to 481)
AUTHORS Polle,A.
TITLE Ectomycorrhiza as a link between trees (Fagus sylvatica) and the
belowground food web
JOURNAL Unpublished
REFERENCE 2 (bases 1 to 481)
AUTHORS Polle,A.
TITLE Direct Submission
JOURNAL Submitted (21-MAR-2012) Forest Botany and Tree Physiology,
Buesgen-Institut, Buesgenweg 2, Goettingen 37077, Germany
FEATURES Location/Qualifiers
source 1..481
/organism="uncultured Clavulina"
/mol_type="genomic DNA"
/isolation_source="mycorrhizal root tip"
/host="Fagus sylvatica"
/db_xref="taxon:228201"
/clone="MT3.2"
/environmental_sample
/country="Germany"
/collection_date="Sep-2009"
/collected_by="K. Valtanen"
/identified_by="K. Valtanen"
/PCR_primers="fwd_name: ITS1F, fwd_seq:
cttggtcatttagaggaagtaa, rev_name: ITS4, rev_seq:
tcctccgcttattgatatgc"
/note="submitted as 'uncultured ectomycorrhiza [Clavulina
cf.cinerea]'"
misc_RNA <1..>481
/note="contains internal transcribed spacer 1, 5.8S
ribosomal RNA, and internal transcribed spacer 2; may also
contain18S ribosomal RNA and 28S ribosomal RNA"
ORIGIN
1 ggatgcatgt gcttgcccta acaatcatct tccaaacacc tgtgcacatt tttgagggag
61 tttcgagttt tattgccgtt tttggtgatt ttcttgtatt cccttgaatt attatacgct
121 gttaacaatg atgaacgtgc tctgtgccgc aaggccatta atataataca acttttaaca
181 acggatctct tggctctcgc atcgatgaag aacgcagcga aatgcgataa gtaatgtgaa
241 ttgcagaatt cagtgaatca tcgaatcttt gaacgcacct tgcgctccct ggtattccgg
301 ggagcacgcc tgttcgagtg tcgcgaaatt tctcaagctt ggatggcctt tttgtctgtc
361 cttagccttg gttgttgggc tttgccgtgt cctttgttgg gacggctggc cttaaaagca
421 ttagctgatc ctcgtgtggc actggttcta ctcagcgtga taacagtctg atcgctgagg
481 a
//
LOCUS JQ982970 428 bp DNA linear ENV 06-MAY-2012
DEFINITION Uncultured Clavulina clone MT3.1 18S ribosomal RNA gene, partial
sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene,
and internal transcribed spacer 2, complete sequence; and 28S
ribosomal RNA gene, partial sequence.
ACCESSION JQ982970
VERSION JQ982970.1 GI:385845710
KEYWORDS ENV.
SOURCE uncultured Clavulina
ORGANISM uncultured Clavulina
Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina;
Agaricomycetes; Cantharellales; Clavulinaceae; environmental
samples.
REFERENCE 1 (bases 1 to 428)
AUTHORS Polle,A.
TITLE Ectomycorrhiza as a link between trees (Fagus sylvatica) and the
belowground food web
JOURNAL Unpublished
REFERENCE 2 (bases 1 to 428)
AUTHORS Polle,A.
TITLE Direct Submission
JOURNAL Submitted (21-MAR-2012) Forest Botany and Tree Physiology,
Buesgen-Institut, Buesgenweg 2, Goettingen 37077, Germany
FEATURES Location/Qualifiers
source 1..428
/organism="uncultured Clavulina"
/mol_type="genomic DNA"
/isolation_source="mycorrhizal root tip"
/host="Fagus sylvatica"
/db_xref="taxon:228201"
/clone="MT3.1"
/environmental_sample
/country="Germany"
/collection_date="Sep-2009"
/collected_by="K. Valtanen"
/identified_by="K. Valtanen"
/PCR_primers="fwd_name: ITS1F, fwd_seq:
cttggtcatttagaggaagtaa, rev_name: ITS4, rev_seq:
tcctccgcttattgatatgc"
/note="submitted as 'uncultured ectomycorrhiza [Clavulina
cf.cinerea]'"
misc_RNA <1..>428
/note="contains internal transcribed spacer 1, 5.8S
ribosomal RNA, and internal transcribed spacer 2; may also
contain18S ribosomal RNA and 28S ribosomal RNA"
ORIGIN
1 gagggagttt cgagttttat tgccgttttt ggtgattttc ttgtattccc ttgaattatt
61 atacgctgtt aacaatgatg aacgtgctct gtgccgcaag gccattaata taatacaact
121 tttaacaacg gatctcttgg ctctcgcatc gatgaagaac gcagcgaaat gcgataagta
181 atgtgaattg cagaattcag tgaatcatcg aatctttgaa cgcaccttgc gctccctggt
241 attccgggga gcacgcctgt tcgagtgtcg cgaaatttct caagcttgga tggccttttt
301 gtctgtcctt agccttggtt gttgggcttt gccgtgtcct ttgttgggac ggctggcctt
361 aaaagcatta gctgatcctc gtgtggcact ggttctactc agcgtgataa cagtctgatc
421 gctgagga
//
perl HostGrabber.pl sequence.gb
>Unknown
GCCCCGTTTTTTGAAATGGGTTCTATTCCCAAACCGTGTATACATACCTATGTTGCTTTGGTAGGCCGCCTTTTAGGCGTCGGCTCCGGCTGACTGCGCCTGCCAGAGGACCCAAACTCTTTTGTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTATAACCACTCAAGCCTCGGCTTGGTCTTGGGGTTCGCGGTCTCGCGG
>Unknown
TCTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGAGTTCATGCCCTTACGGGTAGATCTCCCACCCTTTGAGTACTATACTTTTGTTGCTTTGGCAGGCCGCTTCGGCTACCGGCTTCGGCTGGTGAGTGCCTGCCAGAGGACCCCAAACTCTGAATTATAGTGTCGTCTGAGAACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTATAACCCTCAAGCCTAGCTTGGTGTTGGAGCCTGCCTCTGGGCAGCTCTTAAAATCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTTCTCGCTACAGAGTCCCGGCGGTTGCTTGCCAACAACCCCAAATTTTCTATGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA
>Unknown
TGGTAAGAGAGTGCAGGATGAACAATGGACGATCCGCAGCGAAGACCCTACCGGCGAGAGCCCACGGGTACCGTTCACAGACTAAGTGATTGTGGGCGGGGCGTCAGGCCCTGTCTAAGATATAGTCGGTCTCTGCTCGAAAGGTCAGAGCCTAGCGCGTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAATCGCCCCGTTTTTTGAAATGGGTTCTATTCCCAAACCGTGTATACATACCTTTGTTGCTTTGGTAGGCCGCCTTCTAGGCGTCGGCTCCGGCTGACTGCGCCTGCCAGAGGACCCAAACTCGTTTGTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACAACCAC
>Unknown
AGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGAACTGTTGACACGAGTTGTTGCTGGTCCTTGAAAGGGGGCATGTGCACACTCTGTTTACACATCCACTCACACCTGTGCACCCTCTGTAGTTCTGTGGCATTGGGGACTCTGTCCTCTTGCTGTGGTCCTACGTCTTTACACACACACACCGTAATACAGTCTCATGGAATGTATGTCGCGTTTAACGCAATACAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGCTATTCCGAAGGGCATGCCTGTTTGAGTATCATGAACACCTCAACTCTCATGGCCTGCCATGATGAGCTTGGATTTTGGGGGTCTTGCTGGCCTAACCGTCGGCTCCTCTCAAATGAATCAGCTTGCCAGTGTTTGGTGGCATCACAGGTGTGATAACTATCTACGCTTGTGGTTCTCCACCAGGTAACCTTCAGCAATGGAGGTTCGCTGGAGCTCACAGATGTCTCTCCCCAGGGACAGCTTTTTGAACGTTTGATCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA
>Unknown
ACACGAGTTGTTGCTGGTCCTCAAACGGGGGCATGTGCACGCTCTGTTCACACATCCACTCACACCTGTGCACCCTCTGTAGTTCTATGGTCTGGGGGGGCTCTGCCCTCTCGCCGTGGTTCTATGTCTTTACACACGCACTGTAATAAAGTTTCATGGAATGCATGACGCGTTTAACGCAATACAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCAGAGGGCATGCCTGTTTGAGTATCATGAACACCTCAACTCTCACGGTCCGCCGTGATGAGCTTGGACTTTGGGGGTCTTGCTGGCCTGCGGGTCGGCTCCTCTCAAATGAATCAGCTTGCCAGTGTTTGGTGGCATCACGGGTGTGATAACTATCTACGCTTGTGGTTTTCCACCAGGTAACCTTCAGCAATGGAGGTTCGCTGGGGCTCACAAATGTCTCTCCTCGGTGAGGACAACTTCTTGAATGTTTGATCTCAAATCAGGTAGGGCTACCCGCTGAACTTAAGCATATCAATAA
>Fagus sylvatica
AGGGGGCATGTGCACGCTCTGTTCACACATCCACTCACACCTGTGCACCCTCTGTAGTTCTATGGTCTGGAGGATGCACCGTCTTCCTTCTGTAGTTCTACGTCTTTACACATACGCCCTAGTGAAGTTTTATGGAATGTGTGCCGCGTCTAACGCAATACAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGATATTCTGAGGGGCATGCCTGTTTGAGTATCATGAACACCTCAACTCCTCATGGTTTGCCGTGATGAGCTTGGACTTTTGGAGGTTTTGCTGGCCCTGCTGTCGGCTCCTCTCAAATGGATCAGCTTGCCAGTGTTTGGTGGCGTCATGGGTGTGATAACTATCTACGCTTGTGGCCGTCTGCCAGGTA
>Fagus sylvatica
AGGTGAACCTGCGGAAGGATCATTATTGATAGTTTGTATTATCAAAAACCCCTTTGTTTATCATTTACCATGTTGCTTCCATTGGACAGACCGGCAATTGTGTATACAAAAAGTTGGTCCTCTAGTTTTGTGTTTATTTGGCACTAGCTAGGGAGCTGCCAGTGGATAGAATCCAAATAAAAAATTCGTGAAGAAATATATATTGTCTGATTTATTAGTATAAAAAAAATAAAACTTTCAACAACGGATCTCTAGGCTCTTGCATCGATGAAGAACGCAGTGAAATGCGATAAGTAATGTGAATTGCAGAATCTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTATGGAATTCTGTAGGGCATGCCTGTCTGAGCGTCAGCAGCCAAAAAAATCCAAATCTTTGTAGATAAAGATTTGGATTTGGTTAAGAGATGTAATCTGTGTAAGAACCGGTTACTCTTTTGAAATTTAAAGGCAGTATTGATCAATCCAACTGTAAACGTGATAAAACATTTCGTTTTTATTGTTCGGAATGAGC
>Fagus sylvatica
TTGGGATCATCTCGGAGGGGGCTCGCGTTTTCACACAAACCCCCCTTTTAAAAGTGTAGAATGACCTCATTTATGCGCTAACCCGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAACCTCAACCTCCTTGGTTTCTTCTGGAGACCAAAGCAGGCTTGGACTTTGGAGGCCTTTGCTGGCACCTCTCTTTTGAAGGCCAGCTCCTCTTAAACAAATTAGCAGGGTCCTCTTTGCCGATCCTCGACGTGTGATAAG
>Fagus sylvatica
GGATGCATGTGCTTGCCCTAACAATCATCTTCCAAACACCTGTGCACATTTTTGAGGGAGTTTCGAGTTTTATTGCCGTTTTTGGTGATTTTCTTGTATTCCCTTGAATTATTATACGCTGTTAACAATGATGAACGTGCTCTGTGCCGCAAGGCCATTAATATAATACAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCACGCCTGTTCGAGTGTCGCGAAATTTCTCAAGCTTGGATGGCCTTTTTGTCTGTCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTTGTTGGGACGGCTGGCCTTAAAAGCATTAGCTGATCCTCGTGTGGCACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGAGGA
>Fagus sylvatica
GAGGGAGTTTCGAGTTTTATTGCCGTTTTTGGTGATTTTCTTGTATTCCCTTGAATTATTATACGCTGTTAACAATGATGAACGTGCTCTGTGCCGCAAGGCCATTAATATAATACAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCACGCCTGTTCGAGTGTCGCGAAATTTCTCAAGCTTGGATGGCCTTTTTGTCTGTCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTTGTTGGGACGGCTGGCCTTAAAAGCATTAGCTGATCCTCGTGTGGCACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGAGGA
#!/usr/bin/perl -w
use Bio::Seq;
use Bio::SeqIO;
my $input_file = shift;
my $feat_object;
my $seq_in = Bio::SeqIO->new(
-format => 'genbank',
-file => $input_file,
);
#procedural
while(my $seq = $seq_in->next_seq ) { #for everything in the original input file
# print 'Loading sequence: ', $seq->accession_number,"\n";
for my $feat_object ($seq->get_SeqFeatures) {
push @ids, $feat_object->get_tag_values("host") if ($feat_object->has_tag("host"));
if ($feat_object->has_tag("host")) { print ">", $ids[-1], "\n"; }
else { print ">", "Unknown", "\n"; }
}
$sequence_as_string = $seq->seq;
print "$sequence_as_string", "\n"; #print the fasta seq line
}
perl HostGrabber.pl sequence.gb
>Unknown
>Unknown
GCCCCGTTTTTTGAAATGGGTTCTATTCCCAAACCGTGTATACATACCTATGTTGCTTTGGTAGGCCGCCTTTTAGGCGTCGGCTCCGGCTGACTGCGCCTGCCAGAGGACCCAAACTCTTTTGTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTATAACCACTCAAGCCTCGGCTTGGTCTTGGGGTTCGCGGTCTCGCGG
>Unknown
>Unknown
TCTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGAGTTCATGCCCTTACGGGTAGATCTCCCACCCTTTGAGTACTATACTTTTGTTGCTTTGGCAGGCCGCTTCGGCTACCGGCTTCGGCTGGTGAGTGCCTGCCAGAGGACCCCAAACTCTGAATTATAGTGTCGTCTGAGAACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTATAACCCTCAAGCCTAGCTTGGTGTTGGAGCCTGCCTCTGGGCAGCTCTTAAAATCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTTCTCGCTACAGAGTCCCGGCGGTTGCTTGCCAACAACCCCAAATTTTCTATGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA
>Unknown
>Unknown
TGGTAAGAGAGTGCAGGATGAACAATGGACGATCCGCAGCGAAGACCCTACCGGCGAGAGCCCACGGGTACCGTTCACAGACTAAGTGATTGTGGGCGGGGCGTCAGGCCCTGTCTAAGATATAGTCGGTCTCTGCTCGAAAGGTCAGAGCCTAGCGCGTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAATCGCCCCGTTTTTTGAAATGGGTTCTATTCCCAAACCGTGTATACATACCTTTGTTGCTTTGGTAGGCCGCCTTCTAGGCGTCGGCTCCGGCTGACTGCGCCTGCCAGAGGACCCAAACTCGTTTGTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACAACCAC
>Unknown
>Unknown
AGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGAACTGTTGACACGAGTTGTTGCTGGTCCTTGAAAGGGGGCATGTGCACACTCTGTTTACACATCCACTCACACCTGTGCACCCTCTGTAGTTCTGTGGCATTGGGGACTCTGTCCTCTTGCTGTGGTCCTACGTCTTTACACACACACACCGTAATACAGTCTCATGGAATGTATGTCGCGTTTAACGCAATACAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGCTATTCCGAAGGGCATGCCTGTTTGAGTATCATGAACACCTCAACTCTCATGGCCTGCCATGATGAGCTTGGATTTTGGGGGTCTTGCTGGCCTAACCGTCGGCTCCTCTCAAATGAATCAGCTTGCCAGTGTTTGGTGGCATCACAGGTGTGATAACTATCTACGCTTGTGGTTCTCCACCAGGTAACCTTCAGCAATGGAGGTTCGCTGGAGCTCACAGATGTCTCTCCCCAGGGACAGCTTTTTGAACGTTTGATCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA
>Unknown
>Unknown
ACACGAGTTGTTGCTGGTCCTCAAACGGGGGCATGTGCACGCTCTGTTCACACATCCACTCACACCTGTGCACCCTCTGTAGTTCTATGGTCTGGGGGGGCTCTGCCCTCTCGCCGTGGTTCTATGTCTTTACACACGCACTGTAATAAAGTTTCATGGAATGCATGACGCGTTTAACGCAATACAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCAGAGGGCATGCCTGTTTGAGTATCATGAACACCTCAACTCTCACGGTCCGCCGTGATGAGCTTGGACTTTGGGGGTCTTGCTGGCCTGCGGGTCGGCTCCTCTCAAATGAATCAGCTTGCCAGTGTTTGGTGGCATCACGGGTGTGATAACTATCTACGCTTGTGGTTTTCCACCAGGTAACCTTCAGCAATGGAGGTTCGCTGGGGCTCACAAATGTCTCTCCTCGGTGAGGACAACTTCTTGAATGTTTGATCTCAAATCAGGTAGGGCTACCCGCTGAACTTAAGCATATCAATAA
>Fagus sylvatica
>Unknown
AGGGGGCATGTGCACGCTCTGTTCACACATCCACTCACACCTGTGCACCCTCTGTAGTTCTATGGTCTGGAGGATGCACCGTCTTCCTTCTGTAGTTCTACGTCTTTACACATACGCCCTAGTGAAGTTTTATGGAATGTGTGCCGCGTCTAACGCAATACAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGATATTCTGAGGGGCATGCCTGTTTGAGTATCATGAACACCTCAACTCCTCATGGTTTGCCGTGATGAGCTTGGACTTTTGGAGGTTTTGCTGGCCCTGCTGTCGGCTCCTCTCAAATGGATCAGCTTGCCAGTGTTTGGTGGCGTCATGGGTGTGATAACTATCTACGCTTGTGGCCGTCTGCCAGGTA
>Fagus sylvatica
>Unknown
AGGTGAACCTGCGGAAGGATCATTATTGATAGTTTGTATTATCAAAAACCCCTTTGTTTATCATTTACCATGTTGCTTCCATTGGACAGACCGGCAATTGTGTATACAAAAAGTTGGTCCTCTAGTTTTGTGTTTATTTGGCACTAGCTAGGGAGCTGCCAGTGGATAGAATCCAAATAAAAAATTCGTGAAGAAATATATATTGTCTGATTTATTAGTATAAAAAAAATAAAACTTTCAACAACGGATCTCTAGGCTCTTGCATCGATGAAGAACGCAGTGAAATGCGATAAGTAATGTGAATTGCAGAATCTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTATGGAATTCTGTAGGGCATGCCTGTCTGAGCGTCAGCAGCCAAAAAAATCCAAATCTTTGTAGATAAAGATTTGGATTTGGTTAAGAGATGTAATCTGTGTAAGAACCGGTTACTCTTTTGAAATTTAAAGGCAGTATTGATCAATCCAACTGTAAACGTGATAAAACATTTCGTTTTTATTGTTCGGAATGAGC
>Fagus sylvatica
>Unknown
TTGGGATCATCTCGGAGGGGGCTCGCGTTTTCACACAAACCCCCCTTTTAAAAGTGTAGAATGACCTCATTTATGCGCTAACCCGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAACCTCAACCTCCTTGGTTTCTTCTGGAGACCAAAGCAGGCTTGGACTTTGGAGGCCTTTGCTGGCACCTCTCTTTTGAAGGCCAGCTCCTCTTAAACAAATTAGCAGGGTCCTCTTTGCCGATCCTCGACGTGTGATAAG
>Fagus sylvatica
>Unknown
GGATGCATGTGCTTGCCCTAACAATCATCTTCCAAACACCTGTGCACATTTTTGAGGGAGTTTCGAGTTTTATTGCCGTTTTTGGTGATTTTCTTGTATTCCCTTGAATTATTATACGCTGTTAACAATGATGAACGTGCTCTGTGCCGCAAGGCCATTAATATAATACAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCACGCCTGTTCGAGTGTCGCGAAATTTCTCAAGCTTGGATGGCCTTTTTGTCTGTCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTTGTTGGGACGGCTGGCCTTAAAAGCATTAGCTGATCCTCGTGTGGCACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGAGGA
>Fagus sylvatica
>Unknown
GAGGGAGTTTCGAGTTTTATTGCCGTTTTTGGTGATTTTCTTGTATTCCCTTGAATTATTATACGCTGTTAACAATGATGAACGTGCTCTGTGCCGCAAGGCCATTAATATAATACAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCACGCCTGTTCGAGTGTCGCGAAATTTCTCAAGCTTGGATGGCCTTTTTGTCTGTCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTTGTTGGGACGGCTGGCCTTAAAAGCATTAGCTGATCCTCGTGTGGCACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGAGGA
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
Something went wrong with that request. Please try again.