GSE22631 (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=gse22631). Only partial data is put here.

Experiment descriptors

ExpId	title	reference_ch1	time point_ch2	replicate_ch2	agent_ch2	description
GSM561077	F11_FSK2h_rep1	F11 cells, no forskolin	2hrs	1	10µM forskolin	gene expression data of regenerating dorsal root ganglion neurons
GSM561078	F11_FSK2h_rep2	F11 cells, no forskolin	2hrs	2	10µM forskolin	gene expression data of regenerating dorsal root ganglion neurons
GSM561079	F11_FSK2h_rep3	F11 cells, no forskolin	2hrs	3	10µM forskolin	gene expression data of regenerating dorsal root ganglion neurons
GSM561080	F11_FSK4h_rep1	F11 cells, no forskolin	4hrs	1	10µM forskolin	gene expression data of regenerating dorsal root ganglion neurons
GSM561081	F11_FSK4h_rep2	F11 cells, no forskolin	4hrs	2	10µM forskolin	gene expression data of regenerating dorsal root ganglion neurons
GSM561082	F11_FSK4h_rep3	F11 cells, no forskolin	4hrs	3	10µM forskolin	gene expression data of regenerating dorsal root ganglion neurons
GSM561083	F11_FSK24h_rep1	F11 cells, no forskolin	24hrs	1	10µM forskolin	gene expression data of regenerating dorsal root ganglion neurons
GSM561084	F11_FSK24h_rep2	F11 cells, no forskolin	24hrs	2	10µM forskolin	gene expression data of regenerating dorsal root ganglion neurons
GSM561085	F11_FSK24h_rep3	F11 cells, no forskolin	24hrs	3	10µM forskolin	gene expression data of regenerating dorsal root ganglion neurons
GSM561086	F11_FSK48h_rep1	F11 cells, no forskolin	48hrs	1	10µM forskolin	gene expression data of regenerating dorsal root ganglion neurons
GSM561087	F11_FSK48h_rep2	F11 cells, no forskolin	48hrs	2	10µM forskolin	gene expression data of regenerating dorsal root ganglion neurons
GSM561088	F11_FSK48h_rep3	F11 cells, no forskolin	48hrs	3	10µM forskolin	gene expression data of regenerating dorsal root ganglion neurons

GSE22631_family.soft

^DATABASE = GeoMiame
!Database_name = Gene Expression Omnibus (GEO)
!Database_institute = NCBI NLM NIH
!Database_web_link = http://www.ncbi.nlm.nih.gov/geo
!Database_email = geo@ncbi.nlm.nih.gov
^SERIES = GSE22631
!Series_title = Whole-genome gene expression profiling of F11 dorsal root ganglion (DRG)-like cells stimulated with forskolin
!Series_geo_accession = GSE22631
!Series_status = Public on Jul 01 2010
!Series_submission_date = Jun 30 2010
!Series_last_update_date = Jan 09 2014
!Series_pubmed_id = 21112399
!Series_summary = We generated whole-genome gene expression profiles of F11 dorsal root ganglion (DRG)-like neuroblastoma cells stimulated with the adenylate cyclase activator forskolin for 0, 2, 4, 24 and 48 hours.
!Series_overall_design = F11 neuroblastoma cells were incubated in low-serum medium (DMEM with 0.5% FCS and antibiotics) for three hours and then stimulated with 10 µM forskolin for 2, 4, 24 and 48 hours. All samples are in triplicate. F11 cells incubated in low-serum medium for three hours, but not stimulated with forskolin, were used as a common reference.
!Series_type = Expression profiling by array
!Series_contributor = Harold,D,MacGillavry
!Series_contributor = Jochem,,Cornelis
!Series_contributor = Joost,,Verhaagen
!Series_contributor = August,B,Smit
!Series_contributor = Ronald,E,van Kesteren
!Series_sample_id = GSM561077
!Series_sample_id = GSM561078
!Series_sample_id = GSM561079
!Series_sample_id = GSM561080
!Series_sample_id = GSM561081
!Series_sample_id = GSM561082
!Series_sample_id = GSM561083
!Series_sample_id = GSM561084
!Series_sample_id = GSM561085
!Series_sample_id = GSM561086
!Series_sample_id = GSM561087
!Series_sample_id = GSM561088
!Series_contact_name = Harold,D,MacGillavry
!Series_contact_email = hmacgillavry@gmail.com
!Series_contact_laboratory = Molecular and cellular neurobiology
!Series_contact_department = Center for neurogenomics and cognitive research
!Series_contact_institute = Vrije Universiteit
!Series_contact_address = De Boelelaan 1087
!Series_contact_city = Amsterdam
!Series_contact_zip/postal_code = 1081HV
!Series_contact_country = Netherlands
!Series_supplementary_file = ftp://ftp.ncbi.nlm.nih.gov/pub/geo/DATA/supplementary/series/GSE22631/GSE22631_RAW.tar
!Series_platform_id = GPL4135
!Series_platform_taxid = 10116
!Series_sample_taxid = 10116
!Series_relation = BioProject: http://www.ncbi.nlm.nih.gov/bioproject/PRJNA128185
^PLATFORM = GPL4135
!Platform_title = Agilent-014879 Whole Rat Genome Microarray 4x44K G4131F (Feature Number version)
!Platform_geo_accession = GPL4135
!Platform_status = Public on Aug 17 2006
!Platform_submission_date = Aug 17 2006
!Platform_last_update_date = Jan 09 2014
!Platform_technology = in situ oligonucleotide
!Platform_distribution = custom-commercial
!Platform_organism = Rattus norvegicus
!Platform_taxid = 10116
!Platform_manufacturer = Agilent Technologies
!Platform_manufacture_protocol = see manufacturer's web site at http://www.agilent.com/
!Platform_catalog_number = G4131F
!Platform_description = 
!Platform_description = With a focus on well known rat genes and homologues to human and mouse genes with useful annotation, Agilent's Whole Rat Genome Oligo – 4X44K microarray provides researchers with a new tool for modeling human biology in the rat model organism. For researchers, this means they now have access to a microarray made up of relevant content that has been empirically validated by Agilent.
!Platform_description = 
!Platform_description = Arrays of this design have barcodes that begin with 16014879 or 2514879.
!Platform_description = 
!Platform_description = Orientation:
!Platform_description = Features are numbered numbered Left-to-Right, Top-to-Bottom as scanned by an Agilent scanner (barcode on the left, DNA on the back surface, scanned through the glass), matching the FeatureNum output from Agilent's Feature Extraction software.
!Platform_description = 
!Platform_description = The ID column represents the Agilent Feature Extraction feature number.
!Platform_description = 
!Platform_description = Rows and columns are numbered as scanned by an Axon Scanner (barcode on the bottom, DNA on the front surface).
!Platform_description = 
!Platform_description = To match data scanned on an Axon scanner, use the RefNumber column contained in the Agilent-provided GAL file as the ID_REF column in sample submissions.
!Platform_description = 
!Platform_description = *** A different version of this platform with the Agilent Probe names in the ID column is assigned accession number GPL7294.
!Platform_contact_name =  ,,Agilent Technologies
!Platform_contact_email = cag_sales-na@agilent.com
!Platform_contact_phone = 877-424-4536
!Platform_contact_department =  
!Platform_contact_institute = Agilent Technologies
!Platform_contact_address =  
!Platform_contact_city = Palo Alto
!Platform_contact_state = CA
!Platform_contact_zip/postal_code = 94304
!Platform_contact_country = USA
!Platform_contact_web_link = www.agilent.com
!Platform_supplementary_file = ftp://ftp.ncbi.nlm.nih.gov/pub/geo/DATA/supplementary/platforms/GPL4135/GPL4135_old_annotations.txt.gz
!Platform_relation = Alternative to: GPL7294
!Platform_data_row_count = 45220
#ID = Agilent feature number
#COL = Column
#ROW = Row
#NAME = Name
#SPOT_ID = Spot identifier
#CONTROL_TYPE = Control type
#REFSEQ = RefSeqAccession
#GB_ACC = GenBankAccession LINK_PRE:"http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Search&db=Nucleotide&term="
#GENE = Entrez Gene ID LINK_PRE:"http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=gene&cmd=Retrieve&dopt=Graphics&list_uids="
#GENE_SYMBOL = Gene Symbol
#GENE_NAME = Gene Name
#UNIGENE_ID = UnigeneID
#ENSEMBL_ID = EnsemblID
#TIGR_ID = TIGRID
#ACCESSION_STRING = Accession String
#CHROMOSOMAL_LOCATION = Chromosomal Location
#CYTOBAND = Cytoband
#DESCRIPTION = Description
#GO_ID = GoIDs
#SEQUENCE = 
!platform_table_begin
ID	COL	ROW	NAME	SPOT_ID	CONTROL_TYPE	REFSEQ	GB_ACC	GENE	GENE_SYMBOL	GENE_NAME	UNIGENE_ID	ENSEMBL_ID	TIGR_ID	ACCESSION_STRING	CHROMOSOMAL_LOCATION	CYTOBAND	DESCRIPTION	GO_ID	SEQUENCE
1	266	170	GE_BrightCorner	GE_BrightCorner	pos														
2	266	168	DarkCorner	DarkCorner	pos														
3	266	166	DarkCorner	DarkCorner	pos														
4	266	164	DarkCorner	DarkCorner	pos														
5	266	162	DarkCorner	DarkCorner	pos														
6	266	160	DarkCorner	DarkCorner	pos														
7	266	158	DarkCorner	DarkCorner	pos														
8	266	156	DarkCorner	DarkCorner	pos														
9	266	154	DarkCorner	DarkCorner	pos														
10	266	152	DarkCorner	DarkCorner	pos														
11	266	150	DarkCorner	DarkCorner	pos														
12	266	148	AA892298	A_44_P465448	FALSE		AA892298				Rn.14747			gb|AA892298	chr9:57247899-57249303	rn|9q31	AA892298 EST196101 Normalized rat kidney, Bento Soares Rattus sp. cDNA clone RKIAO74 3' end, mRNA sequence [AA892298]		CCACATCTGTATGCAGTGTCACAGACATTCTCCTTCTTGATGCTTCTAGGGAGCACTATT
13	266	146	AI232741	A_44_P514796	FALSE		AI232741				Rn.12611			gb|AI232741|gb|AW254068|gb|BI278122	chr7:122235251-122235192	rn|7q34	AI232741 EST229429 Normalized rat kidney, Bento Soares Rattus sp. cDNA clone RKICF89 3' end, mRNA sequence [AI232741]		GTTTAAAATTTATTGACGTGATTTCCCATAAGGATGACGGCCCAGAAGCACTCAGCTGTG
14	266	144	NM_057188	A_44_P409518	FALSE	NM_057188	NM_057188	117533	Gmpr	guanosine monophosphate reductase	Rn.3862	ENSRNOT00000023613	TC568850	ref|NM_057188|gb|AF090867|ens|ENSRNOT00000023613|tc|TC568850	chr17:25153992-25153933	rn|17p13	Rattus norvegicus guanosine monophosphate reductase (Gmpr), mRNA [NM_057188]	GO:0003824(catalytic activity)|GO:0003920(GMP reductase activity)|GO:0009409(response to cold)|GO:0016491(oxidoreductase activity)|GO:0030955(potassium ion binding)|GO:0046872(metal ion binding)	GCAGAAGCTGAAGCTTTTCTACGGCATGAGCTCAGACACAGCCATGAAGAAACACGCGGG
15	266	142	XM_236342	A_44_P279262	FALSE		XM_236342				Rn.21843	ENSRNOT00000049602		gb|XM_236342|ens|ENSRNOT00000049602	chr8:69116608-69116667	rn|8q24	Rattus norvegicus similar to CRAG protein (4C711) (LOC315756), mRNA [XM_236342]		TTGGGTTTAACGTCTCTGGTAGATGGAAAGTCTGATGGTTCTAGAACGATTCACACTAAC
16	266	140	NM_001014243	A_44_P375042	FALSE	NM_001014243	NM_001014243	365215	RGD1309888	similar to RIKEN cDNA 1500002O20	Rn.32677	ENSRNOT00000026669	TC521750	ref|NM_001014243|gb|XM_344869|gb|BC087051|ens|ENSRNOT00000026669	chr1:79742705-79743531	rn|1q21	Rattus norvegicus similar to RIKEN cDNA 1500002O20 (RGD1309888), mRNA [NM_001014243]		CCACAGCTGTCGCACACAATCCTCACGGAGAAGAACTGGTTCCACTATGCTGCCAGAATC
17	266	138	XM_222163	A_44_P269499	FALSE		XM_222163				Rn.154560	ENSRNOT00000011278		gb|XM_222163|gb|XR_009247|ens|ENSRNOT00000011278	chr12:30395960-30395901	rn|12q14	Rattus norvegicus similar to 17,000 dalton myosin light chain (LOC304447), mRNA [XM_222163]		TGAAATCCGTCATATCCTAGTCACGCTGGGCGAGAATATGACAGAGGAAGAAGTAGAGAT
18	266	136	AA891661	A_44_P204808	FALSE		AA891661				Rn.1618			gb|AA891661	chr4:84396575-84396516	rn|4q24	AA891661 EST195464 Normalized rat kidney, Bento Soares Rattus sp. cDNA clone RKIAF23 3' end, mRNA sequence [AA891661]		TATTCTGCTGCTTCTAAGCACCTGAAGAATGTGGCTCTCGGTTCACGACATGGTTAACGG
19	266	134	NM_033350	A_44_P438090	FALSE	NM_033350	NM_033350	29322	Plcb3	phospholipase C, beta 3	Rn.16983	ENSRNOT00000028720	TC538381	ref|NM_033350|gb|XM_342005|gb|M99567|ens|ENSRNOT00000028720	chr1:209787835-209787776	rn|1q43	Rattus norvegicus phospholipase C, beta 3 (Plcb3), mRNA [NM_033350]	GO:0004629(phospholipase C activity)|GO:0004871(signal transducer activity)|GO:0007242(intracellular signaling cascade)|GO:0016042(lipid catabolism)|GO:0016787(hydrolase activity)	GGCTCAGGGAGGTTGTCCTGGACGCACATACGACTCAGTTCAAGAGGCTGAAGGAGTTGA
20	266	132	XM_214021	A_44_P330643	FALSE	XM_214021	XM_214021	289561	Polr2b_predicted	polymerase (RNA) II (DNA directed) polypeptide B (predicted)	Rn.153952	ENSRNOT00000039252	TC535070	ref|XM_214021|ref|XM_001075841|gb|CB546931|ens|ENSRNOT00000039252	chr14:33077593-33077330	rn|14p11	PREDICTED: Rattus norvegicus polymerase (RNA) II (DNA directed) polypeptide B (predicted) (Polr2b_predicted), mRNA [XM_214021]	GO:0003677(DNA binding)|GO:0005665(DNA-directed RNA polymerase II, core complex)|GO:0006366(transcription from RNA polymerase II promoter)	AGAGGACATGCCGTTCACTTGTGAAGGCATAACTCCTGACATCATCATAAACCCCCACGC
...
45208	1	25	XM_001081752	A_44_P1070720	FALSE	XM_001081752	XM_001081752	360667	RGD1307394_predicted	similar to hypothetical protein ET (predicted)	Rn.163173		TC517793	ref|XM_001081752|gb|AW253635|gb|AA955448|gb|AW252841	chr10:106986790-106986849	rn|10q32.3	PREDICTED: Rattus norvegicus similar to hypothetical protein ET (predicted) (RGD1307394_predicted), mRNA [XM_001081752]		AGCAGTTGCCACTCTGTGTGGATCCGGAAATGACTCCAACACATATCAGGGATGCTAAGA
45209	1	23	AA891475	A_44_P596890	FALSE		AA891475				Rn.3456			gb|AA891475|gb|BQ780386	chr12_random:590345-590404		EST195278 Normalized rat heart, Bento Soares Rattus sp. cDNA clone RHEAU83 3' end, mRNA sequence [AA891475]		ACCACAACTTTGGCCAAGACCATCCCAACCATAGCTCCCAGGTTCAGCAGTGAAGGATTC
45210	1	21	DarkCorner	DarkCorner	pos														
45211	1	19	DarkCorner	DarkCorner	pos														
45212	1	17	DarkCorner	DarkCorner	pos														
45213	1	15	DarkCorner	DarkCorner	pos														
45214	1	13	DarkCorner	DarkCorner	pos														
45215	1	11	DarkCorner	DarkCorner	pos														
45216	1	9	DarkCorner	DarkCorner	pos														
45217	1	7	DarkCorner	DarkCorner	pos														
45218	1	5	DarkCorner	DarkCorner	pos														
45219	1	3	GE_BrightCorner	GE_BrightCorner	pos														
45220	1	1	GE_BrightCorner	GE_BrightCorner	pos														
!platform_table_end
^SAMPLE = GSM561077
!Sample_title = F11_FSK2h_rep1
!Sample_geo_accession = GSM561077
!Sample_status = Public on Jul 01 2010
!Sample_submission_date = Jun 30 2010
!Sample_last_update_date = Jun 30 2010
!Sample_type = RNA
!Sample_channel_count = 2
!Sample_source_name_ch1 = F11 neuroblastoma cells
!Sample_organism_ch1 = Rattus norvegicus
!Sample_taxid_ch1 = 10116
!Sample_characteristics_ch1 = reference: F11 cells, no forskolin
!Sample_molecule_ch1 = total RNA
!Sample_extract_protocol_ch1 = Total RNA was extracted using Trizol following manufacturer's instructions
!Sample_label_ch1 = Cy5
!Sample_label_protocol_ch1 = Agilent labeling kit, according to manufacturers instructions.
!Sample_source_name_ch2 = F11 neuroblastoma cells
!Sample_organism_ch2 = Rattus norvegicus
!Sample_taxid_ch2 = 10116
!Sample_characteristics_ch2 = time point: 2hrs
!Sample_characteristics_ch2 = replicate: 1
!Sample_characteristics_ch2 = agent: 10µM forskolin
!Sample_molecule_ch2 = total RNA
!Sample_extract_protocol_ch2 = Total RNA was extracted using Trizol following manufacturer's instructions
!Sample_label_ch2 = Cy3
!Sample_label_protocol_ch2 = Agilent labeling kit, according to manufacturers instructions.
!Sample_hyb_protocol = According to manufacturers instructions.
!Sample_scan_protocol = Agilent scanner
!Sample_description = gene expression data of regenerating dorsal root ganglion neurons
!Sample_data_processing = The data were analyzed with the R packages 'bioconductor' and 'limma'. Raw spot intensities were background corrected using Edwards method and loess normalized within arrays.
!Sample_platform_id = GPL4135
!Sample_contact_name = Harold,D,MacGillavry
!Sample_contact_email = hmacgillavry@gmail.com
!Sample_contact_laboratory = Molecular and cellular neurobiology
!Sample_contact_department = Center for neurogenomics and cognitive research
!Sample_contact_institute = Vrije Universiteit
!Sample_contact_address = De Boelelaan 1087
!Sample_contact_city = Amsterdam
!Sample_contact_zip/postal_code = 1081HV
!Sample_contact_country = Netherlands
!Sample_supplementary_file = ftp://ftp.ncbi.nlm.nih.gov/pub/geo/DATA/supplementary/samples/GSM561nnn/GSM561077/GSM561077.txt.gz
!Sample_series_id = GSE22631
!Sample_data_row_count = 43209
#ID_REF = 
#VALUE = Values represent normalized log fold changes relative to the common reference sample.
!sample_table_begin
ID_REF	VALUE
12	-0.252883408
13	0.080360756
14	-0.002192043
15	-0.277088678
16	-0.118405747
17	-0.304502048
18	0.048163755
19	-0.116972778
20	-0.382371486
...
45005	-0.049426219
45006	-0.125253972
45007	-0.142154606
!sample_table_end

GSE22631_series_matrix.txt

!Series_title	"Whole-genome gene expression profiling of F11 dorsal root ganglion (DRG)-like cells stimulated with forskolin"
!Series_geo_accession	"GSE22631"
!Series_status	"Public on Jul 01 2010"
!Series_submission_date	"Jun 30 2010"
!Series_last_update_date	"Jan 09 2014"
!Series_pubmed_id	"21112399"
!Series_summary	"We generated whole-genome gene expression profiles of F11 dorsal root ganglion (DRG)-like neuroblastoma cells stimulated with the adenylate cyclase activator forskolin for 0, 2, 4, 24 and 48 hours."
!Series_overall_design	"F11 neuroblastoma cells were incubated in low-serum medium (DMEM with 0.5% FCS and antibiotics) for three hours and then stimulated with 10 µM forskolin for 2, 4, 24 and 48 hours. All samples are in triplicate. F11 cells incubated in low-serum medium for three hours, but not stimulated with forskolin, were used as a common reference."
!Series_type	"Expression profiling by array"
!Series_contributor	"Harold,D,MacGillavry"
!Series_contributor	"Jochem,,Cornelis"
!Series_contributor	"Joost,,Verhaagen"
!Series_contributor	"August,B,Smit"
!Series_contributor	"Ronald,E,van Kesteren"
!Series_sample_id	"GSM561077 GSM561078 GSM561079 GSM561080 GSM561081 GSM561082 GSM561083 GSM561084 GSM561085 GSM561086 GSM561087 GSM561088 "
!Series_contact_name	"Harold,D,MacGillavry"
!Series_contact_email	"hmacgillavry@gmail.com"
!Series_contact_laboratory	"Molecular and cellular neurobiology"
!Series_contact_department	"Center for neurogenomics and cognitive research"
!Series_contact_institute	"Vrije Universiteit"
!Series_contact_address	"De Boelelaan 1087"
!Series_contact_city	"Amsterdam"
!Series_contact_zip/postal_code	"1081HV"
!Series_contact_country	"Netherlands"
!Series_supplementary_file	"ftp://ftp.ncbi.nlm.nih.gov/pub/geo/DATA/supplementary/series/GSE22631/GSE22631_RAW.tar"
!Series_platform_id	"GPL4135"
!Series_platform_taxid	"10116"
!Series_sample_taxid	"10116"
!Series_relation	"BioProject: http://www.ncbi.nlm.nih.gov/bioproject/PRJNA128185"

!Sample_title	"F11_FSK2h_rep1"	"F11_FSK2h_rep2"	"F11_FSK2h_rep3"	"F11_FSK4h_rep1"	"F11_FSK4h_rep2"	"F11_FSK4h_rep3"	"F11_FSK24h_rep1"	"F11_FSK24h_rep2"	"F11_FSK24h_rep3"	"F11_FSK48h_rep1"	"F11_FSK48h_rep2"	"F11_FSK48h_rep3"
!Sample_geo_accession	"GSM561077"	"GSM561078"	"GSM561079"	"GSM561080"	"GSM561081"	"GSM561082"	"GSM561083"	"GSM561084"	"GSM561085"	"GSM561086"	"GSM561087"	"GSM561088"
!Sample_status	"Public on Jul 01 2010"	"Public on Jul 01 2010"	"Public on Jul 01 2010"	"Public on Jul 01 2010"	"Public on Jul 01 2010"	"Public on Jul 01 2010"	"Public on Jul 01 2010"	"Public on Jul 01 2010"	"Public on Jul 01 2010"	"Public on Jul 01 2010"	"Public on Jul 01 2010"	"Public on Jul 01 2010"
!Sample_submission_date	"Jun 30 2010"	"Jun 30 2010"	"Jun 30 2010"	"Jun 30 2010"	"Jun 30 2010"	"Jun 30 2010"	"Jun 30 2010"	"Jun 30 2010"	"Jun 30 2010"	"Jun 30 2010"	"Jun 30 2010"	"Jun 30 2010"
!Sample_last_update_date	"Jun 30 2010"	"Jun 30 2010"	"Jun 30 2010"	"Jun 30 2010"	"Jun 30 2010"	"Jun 30 2010"	"Jun 30 2010"	"Jun 30 2010"	"Jun 30 2010"	"Jun 30 2010"	"Jun 30 2010"	"Jun 30 2010"
!Sample_type	"RNA"	"RNA"	"RNA"	"RNA"	"RNA"	"RNA"	"RNA"	"RNA"	"RNA"	"RNA"	"RNA"	"RNA"
!Sample_channel_count	"2"	"2"	"2"	"2"	"2"	"2"	"2"	"2"	"2"	"2"	"2"	"2"
!Sample_source_name_ch1	"F11 neuroblastoma cells"	"F11 neuroblastoma cells"	"F11 neuroblastoma cells"	"F11 neuroblastoma cells"	"F11 neuroblastoma cells"	"F11 neuroblastoma cells"	"F11 neuroblastoma cells"	"F11 neuroblastoma cells"	"F11 neuroblastoma cells"	"F11 neuroblastoma cells"	"F11 neuroblastoma cells"	"F11 neuroblastoma cells"
!Sample_organism_ch1	"Rattus norvegicus"	"Rattus norvegicus"	"Rattus norvegicus"	"Rattus norvegicus"	"Rattus norvegicus"	"Rattus norvegicus"	"Rattus norvegicus"	"Rattus norvegicus"	"Rattus norvegicus"	"Rattus norvegicus"	"Rattus norvegicus"	"Rattus norvegicus"
!Sample_characteristics_ch1	"reference: F11 cells, no forskolin"	"reference: F11 cells, no forskolin"	"reference: F11 cells, no forskolin"	"reference: F11 cells, no forskolin"	"reference: F11 cells, no forskolin"	"reference: F11 cells, no forskolin"	"reference: F11 cells, no forskolin"	"reference: F11 cells, no forskolin"	"reference: F11 cells, no forskolin"	"reference: F11 cells, no forskolin"	"reference: F11 cells, no forskolin"	"reference: F11 cells, no forskolin"
!Sample_molecule_ch1	"total RNA"	"total RNA"	"total RNA"	"total RNA"	"total RNA"	"total RNA"	"total RNA"	"total RNA"	"total RNA"	"total RNA"	"total RNA"	"total RNA"
!Sample_extract_protocol_ch1	"Total RNA was extracted using Trizol following manufacturer's instructions"	"Total RNA was extracted using Trizol following manufacturer's instructions"	"Total RNA was extracted using Trizol following manufacturer's instructions"	"Total RNA was extracted using Trizol following manufacturer's instructions"	"Total RNA was extracted using Trizol following manufacturer's instructions"	"Total RNA was extracted using Trizol following manufacturer's instructions"	"Total RNA was extracted using Trizol following manufacturer's instructions"	"Total RNA was extracted using Trizol following manufacturer's instructions"	"Total RNA was extracted using Trizol following manufacturer's instructions"	"Total RNA was extracted using Trizol following manufacturer's instructions"	"Total RNA was extracted using Trizol following manufacturer's instructions"	"Total RNA was extracted using Trizol following manufacturer's instructions"
!Sample_label_ch1	"Cy5"	"Cy5"	"Cy5"	"Cy5"	"Cy5"	"Cy5"	"Cy5"	"Cy5"	"Cy5"	"Cy5"	"Cy5"	"Cy5"
!Sample_label_protocol_ch1	"Agilent labeling kit, according to manufacturers instructions."	"Agilent labeling kit, according to manufacturers instructions."	"Agilent labeling kit, according to manufacturers instructions."	"Agilent labeling kit, according to manufacturers instructions."	"Agilent labeling kit, according to manufacturers instructions."	"Agilent labeling kit, according to manufacturers instructions."	"Agilent labeling kit, according to manufacturers instructions."	"Agilent labeling kit, according to manufacturers instructions."	"Agilent labeling kit, according to manufacturers instructions."	"Agilent labeling kit, according to manufacturers instructions."	"Agilent labeling kit, according to manufacturers instructions."	"Agilent labeling kit, according to manufacturers instructions."
!Sample_taxid_ch1	"10116"	"10116"	"10116"	"10116"	"10116"	"10116"	"10116"	"10116"	"10116"	"10116"	"10116"	"10116"
!Sample_source_name_ch2	"F11 neuroblastoma cells"	"F11 neuroblastoma cells"	"F11 neuroblastoma cells"	"F11 neuroblastoma cells"	"F11 neuroblastoma cells"	"F11 neuroblastoma cells"	"F11 neuroblastoma cells"	"F11 neuroblastoma cells"	"F11 neuroblastoma cells"	"F11 neuroblastoma cells"	"F11 neuroblastoma cells"	"F11 neuroblastoma cells"
!Sample_organism_ch2	"Rattus norvegicus"	"Rattus norvegicus"	"Rattus norvegicus"	"Rattus norvegicus"	"Rattus norvegicus"	"Rattus norvegicus"	"Rattus norvegicus"	"Rattus norvegicus"	"Rattus norvegicus"	"Rattus norvegicus"	"Rattus norvegicus"	"Rattus norvegicus"
!Sample_characteristics_ch2	"time point: 2hrs"	"time point: 2hrs"	"time point: 2hrs"	"time point: 4hrs"	"time point: 4hrs"	"time point: 4hrs"	"time point: 24hrs"	"time point: 24hrs"	"time point: 24hrs"	"time point: 48hrs"	"time point: 48hrs"	"time point: 48hrs"
!Sample_characteristics_ch2	"replicate: 1"	"replicate: 2"	"replicate: 3"	"replicate: 1"	"replicate: 2"	"replicate: 3"	"replicate: 1"	"replicate: 2"	"replicate: 3"	"replicate: 1"	"replicate: 2"	"replicate: 3"
!Sample_characteristics_ch2	"agent: 10µM forskolin"	"agent: 10µM forskolin"	"agent: 10µM forskolin"	"agent: 10µM forskolin"	"agent: 10µM forskolin"	"agent: 10µM forskolin"	"agent: 10µM forskolin"	"agent: 10µM forskolin"	"agent: 10µM forskolin"	"agent: 10µM forskolin"	"agent: 10µM forskolin"	"agent: 10µM forskolin"
!Sample_molecule_ch2	"total RNA"	"total RNA"	"total RNA"	"total RNA"	"total RNA"	"total RNA"	"total RNA"	"total RNA"	"total RNA"	"total RNA"	"total RNA"	"total RNA"
!Sample_extract_protocol_ch2	"Total RNA was extracted using Trizol following manufacturer's instructions"	"Total RNA was extracted using Trizol following manufacturer's instructions"	"Total RNA was extracted using Trizol following manufacturer's instructions"	"Total RNA was extracted using Trizol following manufacturer's instructions"	"Total RNA was extracted using Trizol following manufacturer's instructions"	"Total RNA was extracted using Trizol following manufacturer's instructions"	"Total RNA was extracted using Trizol following manufacturer's instructions"	"Total RNA was extracted using Trizol following manufacturer's instructions"	"Total RNA was extracted using Trizol following manufacturer's instructions"	"Total RNA was extracted using Trizol following manufacturer's instructions"	"Total RNA was extracted using Trizol following manufacturer's instructions"	"Total RNA was extracted using Trizol following manufacturer's instructions"
!Sample_label_ch2	"Cy3"	"Cy3"	"Cy3"	"Cy3"	"Cy3"	"Cy3"	"Cy3"	"Cy3"	"Cy3"	"Cy3"	"Cy3"	"Cy3"
!Sample_label_protocol_ch2	"Agilent labeling kit, according to manufacturers instructions."	"Agilent labeling kit, according to manufacturers instructions."	"Agilent labeling kit, according to manufacturers instructions."	"Agilent labeling kit, according to manufacturers instructions."	"Agilent labeling kit, according to manufacturers instructions."	"Agilent labeling kit, according to manufacturers instructions."	"Agilent labeling kit, according to manufacturers instructions."	"Agilent labeling kit, according to manufacturers instructions."	"Agilent labeling kit, according to manufacturers instructions."	"Agilent labeling kit, according to manufacturers instructions."	"Agilent labeling kit, according to manufacturers instructions."	"Agilent labeling kit, according to manufacturers instructions."
!Sample_taxid_ch2	"10116"	"10116"	"10116"	"10116"	"10116"	"10116"	"10116"	"10116"	"10116"	"10116"	"10116"	"10116"
!Sample_hyb_protocol	"According to manufacturers instructions."	"According to manufacturers instructions."	"According to manufacturers instructions."	"According to manufacturers instructions."	"According to manufacturers instructions."	"According to manufacturers instructions."	"According to manufacturers instructions."	"According to manufacturers instructions."	"According to manufacturers instructions."	"According to manufacturers instructions."	"According to manufacturers instructions."	"According to manufacturers instructions."
!Sample_scan_protocol	"Agilent scanner"	"Agilent scanner"	"Agilent scanner"	"Agilent scanner"	"Agilent scanner"	"Agilent scanner"	"Agilent scanner"	"Agilent scanner"	"Agilent scanner"	"Agilent scanner"	"Agilent scanner"	"Agilent scanner"
!Sample_description	"gene expression data of regenerating dorsal root ganglion neurons"	"gene expression data of regenerating dorsal root ganglion neurons"	"gene expression data of regenerating dorsal root ganglion neurons"	"gene expression data of regenerating dorsal root ganglion neurons"	"gene expression data of regenerating dorsal root ganglion neurons"	"gene expression data of regenerating dorsal root ganglion neurons"	"gene expression data of regenerating dorsal root ganglion neurons"	"gene expression data of regenerating dorsal root ganglion neurons"	"gene expression data of regenerating dorsal root ganglion neurons"	"gene expression data of regenerating dorsal root ganglion neurons"	"gene expression data of regenerating dorsal root ganglion neurons"	"gene expression data of regenerating dorsal root ganglion neurons"
!Sample_data_processing	"The data were analyzed with the R packages 'bioconductor' and 'limma'. Raw spot intensities were background corrected using Edwards method and loess normalized within arrays."	"The data were analyzed with the R packages 'bioconductor' and 'limma'. Raw spot intensities were background corrected using Edwards method and loess normalized within arrays."	"The data were analyzed with the R packages 'bioconductor' and 'limma'. Raw spot intensities were background corrected using Edwards method and loess normalized within arrays."	"The data were analyzed with the R packages 'bioconductor' and 'limma'. Raw spot intensities were background corrected using Edwards method and loess normalized within arrays."	"The data were analyzed with the R packages 'bioconductor' and 'limma'. Raw spot intensities were background corrected using Edwards method and loess normalized within arrays."	"The data were analyzed with the R packages 'bioconductor' and 'limma'. Raw spot intensities were background corrected using Edwards method and loess normalized within arrays."	"The data were analyzed with the R packages 'bioconductor' and 'limma'. Raw spot intensities were background corrected using Edwards method and loess normalized within arrays."	"The data were analyzed with the R packages 'bioconductor' and 'limma'. Raw spot intensities were background corrected using Edwards method and loess normalized within arrays."	"The data were analyzed with the R packages 'bioconductor' and 'limma'. Raw spot intensities were background corrected using Edwards method and loess normalized within arrays."	"The data were analyzed with the R packages 'bioconductor' and 'limma'. Raw spot intensities were background corrected using Edwards method and loess normalized within arrays."	"The data were analyzed with the R packages 'bioconductor' and 'limma'. Raw spot intensities were background corrected using Edwards method and loess normalized within arrays."	"The data were analyzed with the R packages 'bioconductor' and 'limma'. Raw spot intensities were background corrected using Edwards method and loess normalized within arrays."
!Sample_platform_id	"GPL4135"	"GPL4135"	"GPL4135"	"GPL4135"	"GPL4135"	"GPL4135"	"GPL4135"	"GPL4135"	"GPL4135"	"GPL4135"	"GPL4135"	"GPL4135"
!Sample_contact_name	"Harold,D,MacGillavry"	"Harold,D,MacGillavry"	"Harold,D,MacGillavry"	"Harold,D,MacGillavry"	"Harold,D,MacGillavry"	"Harold,D,MacGillavry"	"Harold,D,MacGillavry"	"Harold,D,MacGillavry"	"Harold,D,MacGillavry"	"Harold,D,MacGillavry"	"Harold,D,MacGillavry"	"Harold,D,MacGillavry"
!Sample_contact_email	"hmacgillavry@gmail.com"	"hmacgillavry@gmail.com"	"hmacgillavry@gmail.com"	"hmacgillavry@gmail.com"	"hmacgillavry@gmail.com"	"hmacgillavry@gmail.com"	"hmacgillavry@gmail.com"	"hmacgillavry@gmail.com"	"hmacgillavry@gmail.com"	"hmacgillavry@gmail.com"	"hmacgillavry@gmail.com"	"hmacgillavry@gmail.com"
!Sample_contact_laboratory	"Molecular and cellular neurobiology"	"Molecular and cellular neurobiology"	"Molecular and cellular neurobiology"	"Molecular and cellular neurobiology"	"Molecular and cellular neurobiology"	"Molecular and cellular neurobiology"	"Molecular and cellular neurobiology"	"Molecular and cellular neurobiology"	"Molecular and cellular neurobiology"	"Molecular and cellular neurobiology"	"Molecular and cellular neurobiology"	"Molecular and cellular neurobiology"
!Sample_contact_department	"Center for neurogenomics and cognitive research"	"Center for neurogenomics and cognitive research"	"Center for neurogenomics and cognitive research"	"Center for neurogenomics and cognitive research"	"Center for neurogenomics and cognitive research"	"Center for neurogenomics and cognitive research"	"Center for neurogenomics and cognitive research"	"Center for neurogenomics and cognitive research"	"Center for neurogenomics and cognitive research"	"Center for neurogenomics and cognitive research"	"Center for neurogenomics and cognitive research"	"Center for neurogenomics and cognitive research"
!Sample_contact_institute	"Vrije Universiteit"	"Vrije Universiteit"	"Vrije Universiteit"	"Vrije Universiteit"	"Vrije Universiteit"	"Vrije Universiteit"	"Vrije Universiteit"	"Vrije Universiteit"	"Vrije Universiteit"	"Vrije Universiteit"	"Vrije Universiteit"	"Vrije Universiteit"
!Sample_contact_address	"De Boelelaan 1087"	"De Boelelaan 1087"	"De Boelelaan 1087"	"De Boelelaan 1087"	"De Boelelaan 1087"	"De Boelelaan 1087"	"De Boelelaan 1087"	"De Boelelaan 1087"	"De Boelelaan 1087"	"De Boelelaan 1087"	"De Boelelaan 1087"	"De Boelelaan 1087"
!Sample_contact_city	"Amsterdam"	"Amsterdam"	"Amsterdam"	"Amsterdam"	"Amsterdam"	"Amsterdam"	"Amsterdam"	"Amsterdam"	"Amsterdam"	"Amsterdam"	"Amsterdam"	"Amsterdam"
!Sample_contact_zip/postal_code	"1081HV"	"1081HV"	"1081HV"	"1081HV"	"1081HV"	"1081HV"	"1081HV"	"1081HV"	"1081HV"	"1081HV"	"1081HV"	"1081HV"
!Sample_contact_country	"Netherlands"	"Netherlands"	"Netherlands"	"Netherlands"	"Netherlands"	"Netherlands"	"Netherlands"	"Netherlands"	"Netherlands"	"Netherlands"	"Netherlands"	"Netherlands"
!Sample_supplementary_file	"ftp://ftp.ncbi.nlm.nih.gov/pub/geo/DATA/supplementary/samples/GSM561nnn/GSM561077/GSM561077.txt.gz"	"ftp://ftp.ncbi.nlm.nih.gov/pub/geo/DATA/supplementary/samples/GSM561nnn/GSM561078/GSM561078.txt.gz"	"ftp://ftp.ncbi.nlm.nih.gov/pub/geo/DATA/supplementary/samples/GSM561nnn/GSM561079/GSM561079.txt.gz"	"ftp://ftp.ncbi.nlm.nih.gov/pub/geo/DATA/supplementary/samples/GSM561nnn/GSM561080/GSM561080.txt.gz"	"ftp://ftp.ncbi.nlm.nih.gov/pub/geo/DATA/supplementary/samples/GSM561nnn/GSM561081/GSM561081.txt.gz"	"ftp://ftp.ncbi.nlm.nih.gov/pub/geo/DATA/supplementary/samples/GSM561nnn/GSM561082/GSM561082.txt.gz"	"ftp://ftp.ncbi.nlm.nih.gov/pub/geo/DATA/supplementary/samples/GSM561nnn/GSM561083/GSM561083.txt.gz"	"ftp://ftp.ncbi.nlm.nih.gov/pub/geo/DATA/supplementary/samples/GSM561nnn/GSM561084/GSM561084.txt.gz"	"ftp://ftp.ncbi.nlm.nih.gov/pub/geo/DATA/supplementary/samples/GSM561nnn/GSM561085/GSM561085.txt.gz"	"ftp://ftp.ncbi.nlm.nih.gov/pub/geo/DATA/supplementary/samples/GSM561nnn/GSM561086/GSM561086.txt.gz"	"ftp://ftp.ncbi.nlm.nih.gov/pub/geo/DATA/supplementary/samples/GSM561nnn/GSM561087/GSM561087.txt.gz"	"ftp://ftp.ncbi.nlm.nih.gov/pub/geo/DATA/supplementary/samples/GSM561nnn/GSM561088/GSM561088.txt.gz"
!Sample_data_row_count	"43209"	"43209"	"43209"	"43209"	"43209"	"43209"	"43209"	"43209"	"43209"	"43209"	"43209"	"43209"
!series_matrix_table_begin
"ID_REF"	"GSM561077"	"GSM561078"	"GSM561079"	"GSM561080"	"GSM561081"	"GSM561082"	"GSM561083"	"GSM561084"	"GSM561085"	"GSM561086"	"GSM561087"	"GSM561088"
12	-0.252883408	-0.0247087	-0.317303585	-0.197493613	-0.116559833	-0.018594176	-0.299225031	-0.03392886	-0.097087237	-0.312433122	-0.006008374	0.054344992
13	0.080360756	0.020169715	-0.068080323	0.040796871	-0.035966923	0.155397512	0.225838787	0.117886361	0.08047195	0.21598567	0.195152231	0.210199191
14	-0.002192043	-0.068309688	-0.235050025	-0.117271781	-0.044618351	0.0837161	-0.332804548	-0.666437384	-0.615476634	-0.474878949	-0.453368353	-0.32045835
15	-0.277088678	-0.066819304	-0.321728938	-0.038420125	-0.13220134	-0.164610438	-0.253768487	-0.122552263	-0.283580881	0.165329687	-0.174798057	-0.294074313
16	-0.118405747	-0.273390894	-0.211553406	-0.281463935	-0.147628634	-0.274623502	0.128872991	0.171521064	-0.046190812	0.369457744	0.412627942	0.184190845
17	-0.304502048	-0.055685553	0.015899364	-0.159971316	-0.065692305	-0.086884557	-0.506944497	-0.295889251	-0.47656207	-0.24615346	0.08636249	0.005428025
18	0.048163755	-0.231968686	-0.14253321	-0.116844655	0.096544948	-0.112055976	-0.134796753	-0.010570385	-0.323041671	-0.22350106	-0.384308772	-0.229741218
19	-0.116972778	-0.420979996	-0.304877711	-0.160118476	0.106946623	-0.176322792	-0.146286307	-0.0145322	-0.310002206	-0.306877205	-0.136526986	-0.40355176
20	-0.382371486	-0.038337602	-0.137603442	-0.368404916	-0.26789179	-0.135886877	-0.050661652	0.136312597	-0.08362125	-0.178088482	0.116385937	0.364631317
...
45000	-0.24247638	-0.088001763	-0.19772851	-0.145069457	-0.208632731	-0.185178148	0.184233447	0.431595202	0.444474992	0.345786071	0.364846527	0.497243659
45001	-0.458856895	-0.57542884	-0.660674312	-0.472087373	-0.479579004	-0.418470689	-0.049230357	-0.165502236	-0.129864263	0.075828206	-0.187886846	-0.03788123
45002	-0.269935086	-0.376064718	-0.361127646	-0.096076238	-0.01903622	-0.218935118	-0.005300131	-0.215026447	-0.257423159	-0.051965864	-0.215086644	-0.177496745
45003	-0.041966147	0.093737235	0.093043861	-0.205403796	0.126754809	0.067467969	-0.824960334	-0.757000433	-0.739648339	-0.497927713	-0.382460841	-0.4362647
45004	-0.438138971	-0.180587778	-0.332052241	-0.062393794	-0.140670196	-0.314409674	-0.147531967	-0.096596913	0.007690412	-0.165425029	-0.296957026	-0.256891886
45005	0.019717304	-0.068851267	0.019235094	0.045413845	-0.112623223	-0.015728849	-0.130484016	-0.168444737	0.01956729	-0.172041929	-0.248411333	-0.049426219
45006	-0.431103857	-0.38594631	-0.092585966	-0.212157806	-0.107011213	-0.071012688	-0.177460891	-0.203117415	-0.395944459	-0.088941122	-0.422438588	-0.125253972
45007	-0.186344003	-0.327897979	-0.202163537	-0.072919728	0.013938671	-0.151988402	-0.157577036	-0.141525525	-0.130990766	-0.013390397	-0.161744478	-0.142154606
!series_matrix_table_end